[ [ < ] [ b / g / s / v ] [ Kurallar / Stats ] ]

/b/ - Rastgele

Name
Email
Subject
Comment
File
:
Password (For file deletion.)

File: 1618969827779.jpg (4.49 MB, 6700x4650, 134:93, bokistan3.jpg) ImgOps Google

3f30d No.123534[Last 50 Posts]

Tek tiradda toplayalım dağılmasın.

029f6 No.123535

File: 1618970371079.jpg (2.78 MB, 6700x4650, 134:93, bokistan (2).jpg) ImgOps Google

güzel ama eksik

8594c No.123547

File: 1618990914115.jpeg (225.38 KB, 1439x943, 1439:943, received_337215706923084.jpeg) ImgOps Google

dün gece ben açacaktım sen benim yerime açmışsın eyw op

3f30d No.123554

File: 1618992531676.png (44.62 KB, 590x378, 295:189, ClipboardImage.png) ImgOps Google

şu tezekistan topluluklarının içinde yamtarlar kadar cringe olan başka bir güruh var mıdır? adamların tek yaptığı bokistanın gerçeklerine kulak tıkayıp sırf bokistan halkını yüceltmek hatta dünyanın en üstün ırkı zannetmek. bir de balkanlı mutt osmanlı'nın ve devşirme ordusunun yaptığı savaşlarla övünmeleri ve moğol LARP'ı yapmaları yok mu kek. kendi çorap kokan görüşlerine katılmayanlar için de hemen "yoo sen türk değilsin yoo sen malum ırksın yoo sen türklüğe layıq değilsin t*rklük bir onurdur hurr durr" diye sıçmıklarını yayarlar ortalığa. ben t*rkoların arasında bu kadar delüzyonel ve paranoyak bir güruh görmedim. o mide bulandırıcı bilimum moğol LARP'ı, "t*rke karşı gelmek tengriye karşı gelmektir" kalibresindeki cringeliklerine hiç mi hiç değinmeyeceğim, her gördüğümde cringe paçalarımdan akıyor. işin ilginci sanal ortamda gördüğüm yamtarların yarısına yakını yurtdışında yaşayan gurbetçi. tece denilen cehennemde yaşamadıkları için mi t*rk toplumunu bir bok sanıyorlar yoksa orada gördükleri çingene muamelesi yüzünden bir savunma refleksi mi oluşturuyorlar bilmiyorum. ama dünyada dengi pakistanlı, hindistanlı ve bangladeşli olan bir topluluğun aynı anda kendisini hem avrupalı hem orta asyalı hem akdenizli zannetmesi gerçekten hayret verici. ortadoğulu olduklarını bir türlü kabullenemiyorlar. iki kıtanın arasında sıkışıp kalmış, ne idüğü belirsiz, tezek kokan bir halkın ırkçılığını yapmak da tam bu embesillere yakışır.

813a8 No.123556

>>123554
türkler gayet orjinal bir tarihe ve kültüre sahip bir millettir. bunu ben değil bütün viktorya dönemi yazarlar söylüyor, montesquieu söylüyor. avrupalı osmanlıyı yalamak için oryantalizm kültünü oluşturmuştur. he bangladeş ortadoğu falan.

28671 No.123559

File: 1618995204662.mp4 (1.53 MB, 960x540, 16:9, F5Pdk6P.mp4) ImgOps Google

tek tiradda toplayınca da tiradı gizleyip devekuşluğu yapıyorlar anon

31e7a No.123560

>>123556
türklerin medeniyete bi katkısını söyle o zaman

e97f9 No.123563

File: 1618996488233.jpeg (45.72 KB, 374x820, 187:410, Eq6PLycXUAAIEeg.jpeg) ImgOps Google


3f30d No.123566

File: 1618997229469.jpeg (67.67 KB, 640x480, 4:3, turksubhumans.jpeg) ImgOps Google

>>123556
>türkler gayet orjinal bir tarihe ve kültüre sahip bir millettir.
>avrupalı osmanlıyı yalamak için oryantalizm kültünü oluşturmuştur.

bu bahsettiğin kesim osmanlı'nın yönetici elit kesimiydi ve bokistan halkıyla hiçbir zaman HİÇBİR alakaları olmadı. zaten hepsi kamal tarafından teceden siktir edildikleri için o sofistike kültürleri de beraberlerinde yok olup gitti. bokistan halkı osmanlı'nın mirasçısı falan da değildir. hiçbir zaman olmadı. balkanların kaybedilmesi ile imparatorluğun 500 senedir suratına bile bakmadığı bok kokan anadoluya dikkat buyruldu ve imparatorluktaki bütün müsloların anadoluya toplatılıp yeni "türk" milleti yaratma projesi tasarlandı. bunun sonucu da bugün gördüğün ne idüğü belirsiz halktır.

3f30d No.123577

File: 1619004710227.png (6.16 MB, 1800x1376, 225:172, mike.png) ImgOps Google

varsın türk milleti hâlâ daha osmanlı'da yaşasaydı. varsın c*mhuriyet denilen low IQ her tarafı tezek kokan başarısız projenin tecavüzüne uğramasaydı. ordunun öncülük ettiği, habire bir darbe yapmayı kendine hak gören ekonomisinden tut devlet dairesine kadar hiçbir sikimi işlemeyen, her boka ama her boka köstek olan bu kokuşmuş kamalist rejime aşık olmasaydı. dindar ahlaklı ama aynı zamanda gelişmiş ve kaliteli bir toplum olsaydı. avrupa ve asyayı bağlayan, ortadoğu'nun incisi, tam bir ekonomik ve kültürel bir powerhouse olsaydı. ama insan sadece keşke diyebiliyor işte. osmanlı olmasa bile ingiliz mandası altına girip bir hong kong bir singapur gibi olabilirdik bile hatta. k*mal dışında her şey olabilirdi. v*tan toprağı hakkari van erzurum boyu kürdolara ve ermenilere izmir de yunanlara kaybedilirdi ama gram umrumda değil. ama gel de bunu 600 senelik muhteşem bir kültürü ve mirası sikip atıp, dilin amına koyup alfabeyi komple değiştirip türk dilinin 1000 yıllık korpus'unu, yazı geleneğini ve yazı dağarcığını çöpe atıp bütün potansiyelin amına koyup sıçmıkistan güzellemesi yapan kamalcı yamtarlara anlat. gavatlardan tüm benliğimle nefret ediyorum.

dbadc No.123580

>>123577
>dindar
>gelişmiş
Birini seç

23f48 No.123581

File: 1619007090059.jpg (47.43 KB, 626x398, 313:199, 59c721d145d2a027e83a52d2.jpg) ImgOps Google

>>123577
>600 senelik muhteşem bir kültürü ve mirası

stalin ayetel kürsü okuyup almanları yendi diyen fesli deliden tarih öğrenince böyle fikirler oluşuyor.

b54ed No.123582

>>123566
>>123577
Aradığın duyguların tercümesini Nazım'ın bu şiirinde bul, Türk'lüğe dil uzatma. Azcık erkek olsan bu şiirin benzerini yaz da görelim. Darbukatör ezik.

Sekiz Yüz Elli Yedi

İslam’ın beklediği en şerefli gündür bu
Rum Konstantiniyye’si oldu Türk İstanbul’u

Cihana karşı koyan bir ordunun sahibi
Türk’ün genç padişahı, bir gök yarılır gibi

Girdi Eğrikapı’dan kır atının üstünde
Fethetti İstanbul’u sekiz hafta üç günde

O ne mutlu, mübarek bir kuluymuş Allah’ın!
Belde-i Tayyibe’yi fetheden padişahın,

Hak yerine getirdi en büyük niyazını
Kıldı Ayasofya’da ikindi namazını!

İşte o günden beri Türkün malı İstanbul,
Başkasının olursa, yıkılmalı İstanbul!

Nazım Hikmet

3f30d No.123584

File: 1619008291423.jpg (482.94 KB, 1326x860, 663:430, kamalist.jpg) ImgOps Google

>>123581
>argümanım yok
>fesli deli
>hemen osmanlı ile herhangi bir anlamda alakası olmayan tarikatçıların crowd picture'larını atayım
ortalama t*rk gibi mavihaplı ve low IQ'sun. *kşideki irtica irtica diye diye kafayı bunamış gavatların tekrarladığı sıçmıkları gelip önümüze sunuyorsun.

>fesli deliden tarih öğrenince böyle fikirler oluşuyor.

ÜKM zamanında gerçekleri teker teker açıkladığından olsa gerek rahmetli mezardan hâlâ daha kamalcıları kudurtuyor kek. :DD tarihi tarihçilerden değil de senin gibi 89 IQ'lu NPC'ler gibi ortaokul-lise inkilap ve atat*rkçülük dersinden mi öğrenelim koççum?

>>123582
m*rat pls go :DD

b54ed No.123587

>>123584
tarihimiz kaybolmuş değil, sanki osmanlı zamanında millet okuma biliyordu da her yerde arapça neşriyat vardı sanrısına kapılmışsın.

9f21b No.123588

>asgari ücret rusyanın altında
>en boktan çin malı telefon 2 bin bokistan dinarı
>en boktan bilgisayar 4 bin bokistan dinarı
>bisiklet çarpsa ikiye ayrılacak "otomobil"ler 100 bin bokistan dinarı
>elektrik faturası geçen yılın iki katı
>her gıda ürününün kalitesi ve gramajı daha düşük buna rağmen fiyatı iki kat daha yüksek
okuduğum iktisatçılar, köşe yazarları hala daha kötüye gideceğini söylüyor. bokistan bokunda boğuluyor.

23f48 No.123589

File: 1619009617406.png (925.38 KB, 980x550, 98:55, kadir-mısırlıoglu.png) ImgOps Google

>>123584
evet, deli değildi.

251a3 No.123590

2008'e kadar ne oldu dolar düştü? ve 2008'den sonra ne oldu da dolar çıkmaya başladı?

30f4c No.123591

>>123590
Bu eniklere sorsak ehonomi çoh eyiydi o yıllarda o yüzden. Halbuki işsizlik sefalet aynı olduğu gibi duruyodu, sadece amarka'nın sevdiği insanlar fethullahçılar falan filan yüksek yerlere gelmişti amerika'da ne istese yapabiliyodu. Kozmik oda vs. O yüzden ilişkiler yatırımlar fena değildi dolar da düşüktü.

Ha siz ben ucuza iphone aliyim playstation aliyim tek fethullah ve amerika yine güçlensin diyosanız haksızsınız diyemem. Ama çıkıp bi liberalin fethullahın çatır çatır adam harcadığı yıllara: "o yıllarda en azından hak hukuk vardı" demesine ifrit oluyorum.

251a3 No.123592

>>123591
o yıllarda et döner 2.5 liraydı ve pahalı derdik yiyemezdik.

2a887 No.123593

>>123592
Et dönerin 2.5 lira olduğu yıllarda (ki o gıda boyalı kuyruk yağına et dersek) asgari ücret ne kadardı peki? Bu ülkede ekonomi hiçbir zaman iyi olmadı ve olmayacak bunu öğrenin artık. Yapılacak tek şey batıyla ilişkileri güçlendirip en azından npc orta hallilere azcık refah göstermek. Yani ben ülkenin başkanı olsam öyle yaparım.

Ayrıca bokistan'dan gidecem hacumculara da tavsiyem gitmeyin. Götü boklu türko dişisi bile kahve içme teklifinizi reddetti diye 300 post tirat döşeyen hassas götlü adamlarsınız, batının o kibirli ırkçıları sizi çubuk kraker gibi yer amına koyim. İzmir'in, Çanakkale'nin sakin, çomar free beldelerine gidin daha iyi.

251a3 No.123594

>>123593
asgari ücret ne kadardı 500 filan. alamıyorduk işte. şimdi et döner 15 lira. yine aynı miktarda alabiliyoruz bir şey değişmedi.

8b8a3 No.123595

File: 1619014728730.png (128.96 KB, 966x978, 161:163, rRRHVYG.png) ImgOps Google

S U Ç L U S U =

>k*rtler

>ar*plar
>ing*lizler
>fr*nsızlar
>anadoluya kuzeyden değil güneyden gelen atalarım
>genomundaki x91mw2m12 lokasyonundaki dizilim TAGTAGTAGGATGAGTGAGTAGAGCTAGCTAGCGCATGCATGCATCGATCG olan yani ar*plık olan akp seçmeni

c9e48 No.123597

bugün borsa bir ara yüzde dört eksideydi. daha önce de böyle düşüşler oldu ama erdoğan'a bu kadar çok eleştiri geldiği görmemiştim forumlarda

9f21b No.123601

File: 1619016293735.png (272.89 KB, 533x655, 533:655, ClipboardImage.png) ImgOps Google

>>123595
ülkeye giren her ürün 2 katı yerine 8 katı daha pahalıya giriyor buna karşılık aldığın maaş yerinde saymış hatta düşmüş. sen nasıl alım gücünün düşmediğini iddia ediyorsun?

9f21b No.123602

>>123601
bunaydı >>123594

>>123595
yıllar önce toruda bir anket yapıldı bu ülkedeki en büyük problem hangi etnik kimlik diye türkler ilk sırada çıkınca götüm yanmıştı. şimdi gerçeği görüyorum.

3e2f9 No.123603

File: 1619017009675.png (166.51 KB, 666x375, 222:125, eeee.png) ImgOps Google

>>123602
anket basi 20 lira alan universite ogrencilerinin eline tutusturacagin yanli sorularla istedigin sonucu alabilirsin istedigin yerden. istatistik cok guzel bir bilim.

c2d7d No.123604

File: 1619018150200.mp4 (4.36 MB, 640x640, 1:1, 22.mp4) ImgOps Google


c9e48 No.123605

>>123604
yaramı deşti bu çocuk. kpss'den 91 mi 94 mü ne aldım. ama meslek lisesi mezunu olmadığım için hiçbir yere başvuramadım. 2-3 büro memuru alan yere başvurdum onlar da olmadı. olmayınca tüm umudumu çöpe attım

813a8 No.123692

>>123566
balkanlar şanlı anadolulu tarafından fethedilmiş topraklardır. çocukları köle olarak alınmış ve anadolulu aileler tarafından anadolulu olarak yetiştirilmiştir. viktorya dönemi yazarların erim erim yandığı TAM olarak anadoluludur. bugün antalya'nın pattaya olma potansiyeli varsa, ülke avrupalı karıların sex turizmi lokasyonuysa bunun sebebi anadoluludur.

92ded No.123698

Sevgili anonlar,
"Keşke şöyle olsaydı keşke böyle olsaydı, arapların amına çakayım ah onlar olmasaydı." demek bizi hiçbir yere götürmez. Bu sorunlara başkaları sebep oldu diyerek ağlamak yerine birlikte çözümler üretmeye çalışıp hep birlikte aydınlık bir geleceğe yürümeliyiz. "Ne diyor bu delüzyonel piç?" diyorsanız da kendinizi kurtarmak için bir şeyler yapmalısınız. İlk adım olarak şu soktumun tahtasına veya çanına girmeyi bırakabilirsiniz.

0c626 No.123704

>>123698
>İlk adım olarak şu soktumun tahtasına veya çanına girmeyi bırakabilirsiniz.

https://www.youtube.com/watch?v=lITBGjNEp08

90b31 No.123736

>>123605
E bizim bakir de kpssden 91 puan alıp meslek lisesi mezunu olmadığı için sadece birkaç yere başvuru yapmış onlara da alınmamıştı ama o anlattığında dalga geçiyordunuz.

Tvde evden kaçan çocukları ile ailelerin buluşmasını izleyip ailesi de ilgilenmiyor ki çocuk evden kaçmış diye çocuğa üzülen ama evdeki kendi çocuğuna da eleştirdiği şekilde davranan ebeveynlerden farkınız yok.

babam da zamanında anama çok çektirdi şiddet de uyguladı şimdi haberde kadına şiddet haberleri görünce kendi yapmamış gibi asmak lazım böylelerini birini asın bakalım bir daha böyle hadiseler yaşanacak mı diyor içimden bi siktir çekiyorum.

08a8a No.123738

>>123736
vovovovo. bakirin durumundan haberim bile yok. hıh

08a8a No.123739

>>123738
o değil de bakire çok benziyorum. lokasyon, yaş, ten rengi, karşı cinsle münasebet, kpss puanı. eman tanrım

f0d1b No.124398

File: 1619473346437.png (81.14 KB, 200x200, 1:1, ClipboardImage.png) ImgOps Google

>internet kopuyor eşşek yükü para veriyorsun hızı sik gibi
>rüzgar esse yıkılan, apartman boşluğunda yemek kokusu çocuk ciyaklaması sesi olan, yan komşunun gece dörtte ankara havası açan eşek tırrık olduğu betonundan çalınmış tesisatı sorunlu "ev" 500 milyar
>günde 5 kere avaz avaz imam bağırıyor
>asgari ücretle iş bulunmuyor arabalar 200 milyardan başlıyor
>sağlık güvencesi yok hastaneler çökmüş kanser olsan 16 ay sonraya randevu veriliyor buna rağmen haberin olmadan sağlık sigortası borcu faiziyle birikiyor, hastanelerde yatak yok diye sokağa atıyorlar yandaş televizyon amerika'da sağlık sistemi çöktü diye haber yapıyor

b674c No.124399

File: 1619474585801.jpg (148.34 KB, 836x1000, 209:250, Medeleeff_by_repin.jpg) ImgOps Google

>>123534
aslında o kadar da kötü değil der gibi olduğum an şu tiradlara giriyorum brown pillenip çıkıyorum

ae108 No.124437

>>123534
Orrrrrospu çocuğu bokistan bir yemek yememi bile fazla gördü parasızlıktan sinirlerim bozuldu. İş yok para yok yapacak bir şeyim de yok. intihar edip kurtulam bari

d0491 No.124444

https://youtu.be/zsoVrZLubig
Bokistanlı contenti tüketilmez

fd3fe No.124445


b674c No.124458

>>123535
>>123547
>>123563
>>123581
>>123588
>>123589
>>123601
>>124398
>>124444
>>124445
Bu ülkenin insanından dininden milli dini değerinden bayramından kültüründen her ama her şeyinden bıktım usandım tiksindim artık. Keşke türkiyede doğmasaydım. Türk olduğum için kendimden utanmakla beraber tiksiniyorum. Şu topraklara 1 tek çivi çakarsam şerefsiz namussuz evladıyım

73910 No.124500

File: 1619540388772.jpg (29.33 KB, 643x363, 643:363, TEOMAN.jpg) ImgOps Google

belki bana salak, mal, aptal, gerizekalı vs. diyeceksiniz fakat, her ne kadar sikimistan nefretim en az sizler kadar büyük olsa da, ben burada kalıp son çomar ketlenene kadar mücadele etme taraftarıyım. yurtdışına gitme imkanım yok, olsaydı bile tüm samimiyetimle söylüyorum ki gitmek yerine bulunduğum yeri güzelleştirmek veya çabalarım boşa giderse çomar-free bir yere yerleşip izole bir hayat sürdürmek için harcardım.

f0d1b No.124529

File: 1619564426794-0.png (309.55 KB, 499x485, 499:485, ClipboardImage.png) ImgOps Google

File: 1619564426794-1.png (460.04 KB, 657x537, 219:179, ClipboardImage.png) ImgOps Google

File: 1619564426794-2.png (1.03 MB, 640x853, 640:853, ClipboardImage.png) ImgOps Google

File: 1619564426794-3.png (1.26 MB, 1080x2340, 6:13, ClipboardImage.png) ImgOps Google

>>124500
istesen de çıkamayacağın günler yaklaşıyor.

9e6ed No.124582

File: 1619615106995.png (77.24 KB, 300x300, 1:1, gigaosmanli.png) ImgOps Google

>>123577
İttihat ve Terakki olmasaydı günümüz:

>Devlet-i Aliyye-i Osmaniyye

>İng: The Exalted state (Kısaca Ottoman Empire ya da TES)
>Yıl 2019
>Monark: Kayzer-î Rum
>Yönetim şekli: Meşrut-î Monarşi
>İktidar parti: Fırka-î Ahrar (Liberal parti)
>Legislature: Meclis-î Nev-î Mebûsan
>Anayasa: Kanun-î Esas-î
>Resmi Din: Religious pluralism
>Başkent: Konstantiniyye (Nam-ı diğer: Istanbul, Konstantinopolis, Yeniroma, Nova Roma)
>Nüfus: 45,213,859 (40% Türkmen, 30% Helen, 10% Ermeni, 10% Bulgar+Pomak, 5% Tatar, 5% Çerkez)
>Doğu ve İç anadolu yok
>Balkanlar hâlâ elde
>En gelişmiş Vilayetler sırayla: Istanbul Vilayeti, Selânik Vilayeti, Edirne Vilayeti, Hüdavendigar Vilayeti, Aydın Vilayeti
>Resmi dil: Lisan-ı Osman-î
>Yaygın diller: Türkçe, Yunanca, vs.
>Currency: Para ve Yeni Akçe
>GDP: 68 bin dolar
>Asgari ücret: 1500 dolar
>1 Osmanlı Yeni Akçesi = 2.87 dolar
>HDI: >0.9
>Ortadoğu ve Balkanlar'ın yegane Kültürel ve Ekonomik powerhouse'su
>Minarşist Devlet
>Resmi tatiller: 29 Mayıs, 21 Nisan, 26 Ağustos
>mfw

9e6ed No.124588

File: 1619617380898.jpg (304.89 KB, 1519x808, 1519:808, bokistan serzenişi no bilm….jpg) ImgOps Google

>>124582
Snap back to reality:

>Dürrükiye """"cumhuriyeti"""" (ülkeyi diktatör kurmuş, her 10 sene darbe oluyor)

>İng: Hindi (kek)
>Yıl 2021
>498257194234: tezekistan diktatörü: tayyar
>Yönetim şekli: Askeri Despotizm
>İktidar parti: Makarna kömür partisi
Muhalefet: c*hape + PKK partisi
>Legislature: TBMM denilen hiçbir sikime yaramayan şer odağı
>Anayasa: 82 anayasası (bol bol 5816lı)
>Resmi Din: Kamalizm ve Yamtarlık (Nam-ı diğer: ""Laiklik"")
>Başkent: ank*ra (memur wasteland)
>Nüfus: 82 milyon (60% tırk, 20% KÜRD, 20% Suri boğa + afgan buğa ve diğer üçüncü dünyalılar)
>Doğu ve İç anadolu nüfusun çoğunu oluşturuyor
>Balkanlardan geriye kalan tek şey götüboklu trakya ve istanbul kanalı + ARAB buğalara satılan tekirdağ arazileri
>En gelişmiş iller sırayla: Hakkari, Şırnak, Bayburt, Artvin
>Resmi dil: Yörüngeselözyönetimerksel gibi uyduruk kelimeler barındıran fakir dil
>Yaygın diller: İngilizce (kek), ARABi
>Currency: dürrük lirası
>GDP: 8 bin dolar
>Asgari ücret: 350 dolar (70% asgari ile çalışıyor)
>1 dırrık lirası = 0.12 dolar
>HDI: 0.6
>kıyaslayınca götüboklu romanyanın bile daha yaşanabilir olduğu bir cehennem
>her boka karışan devlet, HİÇBİR anlamda özgürlük yok, verginin vergisi alınıyor, hizmet de sıfır
>Resmi tatiller: 29 ekim, 23 nisan, 10 kasımda vasat diktatör için ayağa kalkmayanın kafasına sıkacağız ve bilimum yamtarlıklar
>mfw

6ef19 No.124591

Tirad açacaktım da baktım bokistan sikim tiradı varmış zaten. Neyse şunu diyecektim:

BUNDAN BİLMEM KAÇ SENE ÖNCE BOKİSTANIN KOZMİK ODASINA TARİKATÇİLER ELİNİ KOLUNU SALLAYARAK GİRİP 125 MİLYON SAYFALIK BELGEYİ TUTANAKSIZ BİR ŞEKİLDE KOPYALAYIP DIŞARI ÇIKARDILAR


KEK BE. aklıma geldikçe günüm yapılıyor. Literally ülkeye ait bütün sırlar ve planlar, aklınıza gelebilecek her türlü bilgi bir sahte ihbar üzerine yabancı ülkelere ve tarikatlere servis edildi :DDDD Bunun karşılığında ne kamalcılar, ne de ordudan bir allahın kulu parmağını kaldırabildi. Sikindirik suriye'de bile böyle bir şey olmamıştır. Irak işgal edilirken bile o belgeler sızmayıp ateşe verilmiştir. Tezekistan'da ise hiçbir efor sarf edilmeden seve seve verildi o belgeler :DDD

KEEEEEEEK

ab731 No.124594

>>124591

sadece kek

a2f54 No.124602

File: 1619627385551.mp4 (2.19 MB, 400x226, 200:113, eskigüzelgünler.mp4) ImgOps Google

>>124529
bu saatten sonra çıkıp çıkmamak sikimde değil zaten. ben bu memleketin en azından 90'lı yıllara, akp öncesi özgürlük yıllarına dönmesini arzuluyorum fakat asla o günlerin geri gelmeyeceğinin de artık farkındayım maalesef. sadece ortalama bir çomarın artık sokaklarda gerine gerine dolaşmak yerine korkarak dolaştığı günlerin hayalini kuruyorum.

c6ebc No.124658

>>124602
>Yamtar mahzeninden bildirdi

e5d88 No.124660

File: 1619647415942.mp4 (87.33 KB, 480x270, 16:9, lmao.mp4) ImgOps Google

>>124602
>eskigüzelgünler.mp4
>ben bu memleketin en azından 90'lı yıllara, akp öncesi özgürlük yıllarına dönmesini arzuluyorum
>t. 2000 doğumlu
Yahu anon banlanmak istemediğimden altyaş falan demiyorum da sahiden kaç yaşındasın be amına koyayım. Bokistanın boktanlığını sırf AKP'ye bağlaman yetmiyormuş gibi kamalcıları kurtarıcı olarak görmen ki asıl sorunun kaynağının betoncular olduğunu idrak et önce. Çomar avı falan bu ne be cringe paçalarımdan aktı resmen. Militarizm gibi sikik sokuk yamtar yüzkitabı sayfalarındaki ergen türkoların yaptığı ki tane sikindirik /pol/ çakması nazi rp'si videosu izleyip etkilendin diye hiç yaşamadığın dönemler hakkında atıp tutuyorsun.

94d17 No.124664

>>124602
Kek akpnin en az darbeciler kadar kamalist olduğunu idrak edememişsiniz.
Sorun çomarlarda değil kemalizm hastalığı sorun

2c80b No.124675

File: 1619655743995-0.png (474.45 KB, 520x520, 1:1, neslişah sultan at.png) ImgOps Google

File: 1619655743995-1.png (474.45 KB, 520x520, 1:1, neslişah sultan at.png) ImgOps Google

File: 1619655743995-2.jpg (70.77 KB, 620x379, 620:379, neslişah sultan at 2.jpg) ImgOps Google

>>124582
waxxxxxxxxxx
düşünsene şöyle 4 dil bilen, kültürlü, sportmen, asil, hobileri olan bir aristokrasi-hanedanlık var ülkede
bir de şimdiki erdoğan ailesine falan bak kafayı yememek elde değil. dediğin gibi olsa en kötü ispanya ayarında bir ülkeydi. kolonyal bir devlet olsa bile en kötü malezya ayarında olurdu. tabi bunları maddi anlamda söylüyorum. müthiş bir kültürel zenginlik, birikim alanına girmiyorum bile.
>>124658
>>124660
>>124664
bunlar. büyük ihtimal reddit-discordda falan görüp kendi kendine tribe girmiş altyaş. cringeden kolum kasıldı.

8acd4 No.124676

>>124658
>verecek cevabım yok

>>124660
yaşım 28

ayrıca mevcut kamalizmin de bir sike yaramadığının farkındayım çocuğum. bu ülkeye sil baştan bir devrim şart sadece, zira yarın akp gider yerine başka bir çoban gelir

>>124675
>>124664
asıl siz beni cringe ettiniz enikler. reddit'in de amına koyayım bu arada, üyeliğim bile yok. dediğiniz sayfaları da bilmiyorum

23309 No.124677

>>124675
Kültürlü diye başımıza mı getiricez zihniyete bak sanki ülkenin tek sorunu rtenin hiç resim çizmemesi golf oynamaması…

f0d1b No.124682

>>124675
>düşünsene şöyle 4 dil bilen, kültürlü, sportmen, asil, hobileri olan bir aristokrat karını acımadan sikiyor
asıl demek istediği bu. tırrık güdülmeye muhtaçtır, bireysellik onun için yabancı ve düşman bir kavramdır; daima başında yüce melekelere sahip olan bir çobana ihtiyaç duyar, bu sayede kendini güvende ve mutlu hisseder.

2c80b No.124694

>>124682
haklısın monarkın olduğu ingiltere, bae, monaco, danimarka, lüksemburg, belçika'da bireysellik cumhuriyet olan türkiye, iran, hindistan, ıraktan falan daha kötü durumda hep çobana ihtiyaç duyuyorlar ondan.

f0d1b No.124699

File: 1619691156291.png (207.36 KB, 633x508, 633:508, ClipboardImage.png) ImgOps Google

>>124694
sen şimdi bokistan'da monark olmadığını mı iddia ediyorsun? sokakta cebinde çakı taşımana izin vermeyen ingiltere'de bireysel özgürlük olduğunu mu ima ediyorsun?

30cb4 No.124748

>>124602
>eşcinselliği yeni türkiye alameti olarak göster
>eski türkiye alameti olarak gösterdiğin adam literal olarak eşcinsel olsun

5babd No.124919

File: 1619799903049.jpg (701.23 KB, 1080x2160, 1:2, Screenshot_2021-04-30-19-2….jpg) ImgOps Google

>bulgur palas

ölürüm bokistan

95750 No.124922

>>124919
tarhana center diye bir tarihi yapı var mıdır?

c101d No.124927

>15 ülkeden bokistan'a gelecek olanlara pcr testi zorunluluğunu kaldır
>sırf bayram sonrası turist çekebilmek için kimsenin siklemediği bir sokağa çıkma yasağı koy
>hazır elim değmişken şu alkolü de yasaklayayım de, millet alkol reyonlarını perdeyle örtüp satışa devam etsin
>REİS çıkıp "kapanmada en kötü ihtimalle bokistan'dayım" desin

170a0 No.124932

File: 1619805792462.png (84.24 KB, 1023x990, 31:30, Screenshot_2021-04-24 Imag….png) ImgOps Google

yazık ülke ne hale gelmiş

83311 No.124956

>>124932
link atsana kanser hücresi

267dd No.124970


1957e No.125011


de0a1 No.125029

>>125011
çöp ithal etmek nedir gerçekten anlam veremiyorum.

29e0a No.125031

>>125029
Bu konu bir anda peydah olmadı, zaten yıllardır konuşuluyor. Hakkında belgeseller bile yapıldı. Üçüncü dünya ülkelerine çöp satılıyor, o ülkeler de çöpleri geri dönüştürüyor. Win-win durumu var yani. Bizim bok beyinliler ise hem çöp almak için para verip hem de o çöpleri geri dönüştürmeyip bir kenarda bekletiyor ya da yakıyor.

c5cbb No.125100

File: 1619956649297.webm (10.19 MB, 640x360, 16:9, bokistan hr0DwNmzlYo 43.webm) ImgOps Google

in this itt içindekiler:

e5f31 No.125119

>z kuşağı hacum

https://www.youtube.com/watch?v=fbEA1peP8B4

>bumcular ketleniyor sayıları azalıyor hajum


https://www.youtube.com/watch?v=sgsoK9doOtI

burada ve ön bahçede azınlığız, ülke nüfusunun taş çatlasın %1'ini oluşturuyoruz anlayın artık bunu.

c831f No.125160

File: 1619983395726-0.jpg (70.75 KB, 865x487, 865:487, piknik_16_9_1533538305.jpg) ImgOps Google

File: 1619983395726-1.png (851.17 KB, 810x458, 405:229, ClipboardImage.png) ImgOps Google

bir ülkede hiç mi güzel bir şey olmaz. boğulmamak elde değil. rahat rahat nefes bile alamıyorum. kafamı çeviriyorum her yerde eciş büçüş ucube yapılar, müteahhitlerin malzemeden çalıp üst üste yanyana diktiği apartmanların 30 yıllık beton duvara karşı kontrast yapan minimalist tabelaların yarattığı çirkinlik. iç tasarımı bile boğucu bembeyaz duvarlar ışıltılı pembe mobilyalardan ibaret olan süslü ahırlarda yaşıyor herkes. şu amerikan suburb'larıyla bile daşşak geçiyorlar ama onlar en azından bokistan kümeslerinden iyidir. garajı var, özgür ve ferah alanı, bahçesi vs. cennetistanın en boktan binası bile bokistanın ortalama binasından daha estetik. devlet o kadar vergi alıyor buna rağmen şu "halka hizmet" diye diktikleri millet bahçelerine bak, türbanlı "mimar"ların tasarladığı boğucu estetik kalitesi tezekle aynı, betonarme, göt göte ortada yarrak gibi duran bütün dalları budanmış ağaçlar, resmen ahır gibi, gerçi ahırın bile bir doğallığı var böyle sentetik değil. bütün hobisi apartmanında oturup maç ve haber izleyip keyif çayını içmek ve mangalda mutant tavuk kanadı yemek olan bir topluma anca bu yakışır zaten.

bu allahın belası devletin aldığı para ile sunduğu hizmetin yüzde biri bile değil. amerikada insanlar 50 yaşına kadar çalışır devlet minimum vergi aldığı için parasını biriktip emekliye ayrılır krallar gibi hayatını yaşar. bizim moruklar da ömrü boyunca devlet her boka konduğu için hiçbir birikim yapamayıp eline geçen ilk fırsatta bütün sermayesini çarçur edip 40-50 yıl günde 10 saat karın tokluğuna çalışır en sonunda da kümesinde otururken devletin verdiği 300 dolarlık emekli maaşıyla hayatta kalmaya çalışır. yaşlanınca hayatı yaşamakmış hobiymiş uğraşmış kendi işini kurmakmış bunların hiçbirisinin önemi yok bu moruklar için, anca ahırda oturayım bayramdan bayrama sevimsiz meymenetsiz cırtlak torunlarımı seveyim. bu devlet istiyor ki bu insanların hiçbir şeyi olmasın, eğlenemesinler, uğraşları olmasın, anca tavuk gibi otursunlar her boku devletten istesinler, varını yoğunu ne varsa devlete versinler, devlet de bunlara kalitesiz sağlık, kalitesiz eğitim ve kalitesiz hizmet versin. devletin ve eğitim sisteminin idealize ettiği vatandaş bu. tembel ve iq'su düşük topluma böyle bir bakıcı devlet yapısı yakışır. hiç param ve vergilerim nereye gidiyor gibi soru da sormazlar. sağılmaktan ve güdülmekten oldukça memnunlar.

794ce No.125161

File: 1619984588880.jpg (38.86 KB, 1147x876, 1147:876, 7381638191737.jpg) ImgOps Google

kek

a90fc No.125169

>>125161
amını siktiğimin ülkesinden gittiğim gün toprağı taşı öpecem

ddc02 No.125201

>>125161
clio 165 bin gardaşım herkesin bodrumda yazlığı var

50da7 No.125230

>yabancı melek gibi kızları sosyal medyada ekle uzun uzun konuşun, birbirinizden hoşlanın belki sexting yapın nudelaşın
>t virüslerini sosyal medyadan ekle, sen kimsin, neden ekledin, insan gibi cevap verince de çingene gibi küfür etmeye başlasınlar

Anasını siktiğimin kanser toprakları

4b86a No.125284

>>123559
Anon, burada neyden bahsediyor şişko ermeni?

717b9 No.125285

>>125160
düşüncelerimin büyük bir kısmını yazıya dökmüşsün ağzına sağlık kıymetli dostum. (you) vermek istedim.

21386 No.125305

Tek çözüm var k*rt ar*b s*ri ve diğer 3. dünya hayvanlarını ülkeden atmak. İbneleri yakmak - İslam'ı bitirip Tengri inancını getirmek Tayyip, Kılıçdaroğlu, Devlet Bahçeli piçini kovup gerçekten milliyetçi,zeki ve dejenere olmayan bir lider getirmek. Tekrar özümüze Orta Asya Türklerine dönmek npc kitleye söylüyorum laiklik - hoşgörü istiyorsanız siktir olun gidin Avrupistana Türkiye Türklerindir.

f399a No.125362

>>125305
bence daha iyi bir çözüm hepsinin ananı trk bayrağının üstüne yatırıp sırayla döllemesi :D

8b7f1 No.125363

>>125305

Kek, buradaki yamtar sen misin lan >>125259 ? Hasiktir git orta asya çöllerine kılıç artığı piç seni

eae5b No.125375

File: 1620154446182.jpg (117.06 KB, 780x501, 260:167, 05172017_argentina-slum_11….jpg) ImgOps Google

günlük hatırlatıcı
türkiye meksika, brezilya, arjantin, filipinler, bangladeş eşseviyesinde bir ülkedir. bu ülkeler gibi yozlaşmış bir "failed state"dir. rüşvet, nepotizm, uyuşturucu, mafya, darbe, gecekondulaşma, 0 üretim ve dünyaya katkı, devletin yaratıp desteklediği elit sınıf hepsinde ortak noktadır ve kültürleri benzemektedir. insanları tembel, yalancı ve şark kurnazıdır. ne kadar benzediklerini sadece hepsinde aynı olan boktan tv programlarına bakarak bile anlayabilirsiniz.
https://www.youtube.com/watch?v=qbgE3Qwml70

0ef38 No.125539

File: 1620310406373.jpg (59.91 KB, 880x495, 16:9, mandira-filozofu-nerede-ce….jpg) ImgOps Google


0e42e No.125783

File: 1620545838563.jpg (275.79 KB, 1108x1478, 554:739, ETisRQTU8AADrZ-.jpg) ImgOps Google

japonya'da 16 kızdan 10'u güzelken türkiye'de 16 kızdan 2'si güzeldir yanlışsam düzeltin

3e2f9 No.125784

>>125783
yanlışsın

ac597 No.125785

>>125784

aksini kanıtla sageci anon bugün 2. yapıyorsun

3588f No.125787

>>125783
sen hiç yanlış olur musun tövbe haşa anon çarpılır gideriz valla.

21bff No.125789

Türk nefretçiliği yapanlar, habbı yutun, tüccarın oyununa gelmeyin:
https://www.youtube.com/watch?v=rbJF1L97HoY

>>125783
Hepsi melek gibi

841d8 No.125807

tahta vücutlu bunlar güzel değil

f399a No.125810

>>125789
>trkofobi hajum
>barbar götümüzü sevmiyorlar hajum
zenofobi arşa çıkmalı, yalan tarih kötü bir şey değil diyen de sen değil misin? sen nasıl istiyorsan öyle yapıyor işte adamlar.

21bff No.125905

>>125810
>yalan tarih kötü bir şey değil diyen de sen değil misin?
ben kimim ve ne zaman öyle bir şey demişim?

>barbar götümüzü sevmiyorlar hajum

adam belgeleriylen açıklamış neden sevilmediğimizi, var mı aksini kanıtlayacak bir fikrin?

5f54e No.125911

File: 1620590906493.jpg (153.98 KB, 1600x900, 16:9, skw39.jpg) ImgOps Google

>>125905
>var mı aksini kanıtlayacak bir fikrin?
sizi ben de sevmiyorum. aksini neden kanıtlayayım ki?

3a366 No.125950

File: 1620640468055-0.jpg (436.92 KB, 1536x2048, 3:4, E08F3PxWEAUAOcv.jpg) ImgOps Google

File: 1620640468055-1.jpg (331.96 KB, 1536x2048, 3:4, E08F5fRWEAEwIRF.jpg) ImgOps Google

diyarbakır'daki karpuz içinde çocuk heykeli

bu çomarlar niye hala heykel konusunda zevksizliğe devam ediyor?

ff82d No.125952

File: 1620641459532.jpg (99.98 KB, 640x856, 80:107, a2u1z5EiIc9yi6ug46QzXMCSEU….jpg) ImgOps Google


82b35 No.125980

File: 1620667216136.png (2.45 MB, 2351x953, 2351:953, ClipboardImage.png) ImgOps Google

>>125950
nerdeeen nereye.

3bf33 No.125991

File: 1620677535068.jpg (26.12 KB, 739x415, 739:415, 20210510_231127.jpg) ImgOps Google

AHAHAHAHAHAHAHAHAAHAHAHAHA

485da No.125993

>>125991
when alev alev anon?

8b8a3 No.126010

File: 1620723665113.jpg (1.08 MB, 2100x1400, 3:2, Microrayon_w_drying_laundr….jpg) ImgOps Google

sizce bu resim hangi şehirden?

1b3e6 No.126011

File: 1620723863137.jpg (287.09 KB, 1200x805, 240:161, 1200px-Paldiski_2006-2.jpg) ImgOps Google

>>126010
Paldiski, Estonya'nın Harju iline bağlı belediyelerden biridir. Yüzölçümü 60.17 km² olan yerleşim biriminin nüfusu 4,224'tür. Kilometrekareye yaklaşık 70,2 kişi düşer.

44ee8 No.126058

grand prix ket
şampiyonlar ligi finali ket

41984 No.126129

>>125305
>özümüze, orta asya türklerine dönmek
keeeeeeeeeeek
türk degilsin. arap, kürd, yunan karışımı bir mutt sın

d4cbf No.126387

File: 1620941437233.jpg (361.52 KB, 1300x1300, 1:1, iq-europe.jpg) ImgOps Google

>literally avrupa asya amerikadaki en düşük ortalama iq
>üstüne muhafazakar toplum yapısı ve islamı ekle

Yemin ederim maymunistan, afrikada doğmak daha mantıklı en kötü yerinde fakir doğsan bile mazot çekip tavşan gibi sikişir erken yaşta da geberip giderdim

db3cd No.126421

>>126387
brezilya bitti afrika mı başladı spamcı?

2ed6a No.126482

File: 1621012990717.png (1.84 MB, 1366x768, 683:384, ClipboardImage.png) ImgOps Google

Tamam hadi ekonomi leş olur insanlar çiğ köfte yemekten gelişemez anlarım da, bir ülkede hiç mi güzel bir şey olmaz. Hiç mi güzel adeti, gelenek göreneği olmaz, plastik sandalyede sokak düğününden öte gitmiyor hiçbir şey, ülkenin genelinde insanı boğan yazısız bokistan kuralları var, bu hava hepimizi strese sokuyor zaten.

En azından doğası güzel olur ki en rare bölgelerde bile pet şişe yığınına dönüşmüş. Her güzel yeri şahinden ankara havası oynatan böcekler istila etmiş, Güzel bir şey göremiyorum.

Tamam o zaman seks yapmak kolay olur en azından, afrikadaki gibi. Aidsten gidersin ama en azından mutlu bir hayat geçirirsin seks yaparsın, doğa cennet gibi, kendine has kültürü var, insanları barbar değil, güzel şeyler hissedebiliyorsun.

Bayrağı bile osmanlı çorabı mı kokar bir ülkenin? Hiç iyi bi şey olmaz mı bir ülkede? Şaka gibi gerçekten, insanları leş ve barbar, hoşgörü zeka hak getire. Sokaktaki manzara nazar boncuklu beton yığınlarından ibaret, yaşıyorum ulaaaan diye bağırabileceğin kendini insan gibi hissedebileceğin bir yer bile yok.

Et bile alırken 2 yıl garantiyle alacak durumdasın zaten bunun üstüne baskı ve stres, kötü aptal ve zevksiz insanlar, leş yapılaşmayı, islamı, camiileri eklediğimde boğulacak gibi oluyorum.

2ed6a No.126486

File: 1621015030991.png (5.9 MB, 2560x1440, 16:9, ClipboardImage.png) ImgOps Google

türkler neden çalışacakları zaman işi taşağa verip eğlenecekleri zaman da ciddi kesiliyorlar? yok rakı şöyle içilmez böyle içilir adabı vardır falan. alt tarafı içip eğleneceksin ortamı niye geriyorsun. plebbitte de bir türko bokposting subuna bakayım dedim 50 tane ciddi kural döşemişler. ciddi olacakları zaman da dalga geçerler sürekli. ne çalışmasını, ne eğlenmesini bilmeyen, her şeye zıt ilerleyen iğrenç bir millet.

f68df No.126566

>>126486
Bu kadar kural saçma askeriye sisteminde bile yok boş boş yazılar işte al içkini evinde uslu uslu iç

00d51 No.126591

tuttuğu takım şampiyon oldu diye akşamın bu saatinde insanların rahatını bozmayı kendine hak gören neandertaller doldu yine sokağa. bi de sözde tam kapanma var. 4-5 tane spor mafyası zengin oldu diye boğazı yırtılana kadar bağırıp kornayla geziyo adamlar. sorsak kendisi kıt kanaat geçiniyodur. şampiyonluk primi almış sporcular bu kadar sevinmiyodur amına koyim, şimdi hepsi evinde oturmuş dinleniyodur. allax'ım sinir hastası etmeden kurtar beni şu lağım diyarından artık.

853fe No.126592

>>126591
dünyanın her yerinde var bununla anlaş

05a50 No.126593

>>126592
nerede var allax aşkına amerikada nfl i kazanan veya nbade bir takım kazanınca herhangi bir eyaletin herhangi bir şehrinde sokaklarda kornalar basarak bağıranların olduğu bir video at bakayım bana bir.

93a24 No.126598

File: 1621109777782.jpg (172.16 KB, 656x400, 41:25, barbaros sansal.jpg) ImgOps Google

>>126592
daha geçen belçika'da kornalı konvoy yapan eşşek türkolara ceza kesildi bi de üstüne utanmadan ırkçı polis falan diye ağladılar. google'da arat bulursun haberi. bilip bilmeden konuşuyosunuz amına koyim sanki biz hiç kutlama olmasın dedik, şu yukardaki anonun dediği gibi bi tane örnek versene batıdan. futbolun başkenti ingiltere'de bile bu yamyamlık yok. size laf anlatmaktan bıktım übş'nin dediği gibi bokunuzda boğulun. Ellax gavatı izin verirse Ekim'de başvurumu yapıp DV-2023'le gidip Tunay'ın bi bardak çayını içeceğim.

70077 No.126625

File: 1621152976608.png (79.81 KB, 933x349, 933:349, 3WMag6h.png) ImgOps Google

revizyon şovu

35209 No.126732

File: 1621193758946.jpg (77.5 KB, 1369x518, 37:14, Capture.JPG) ImgOps Google


aa4da No.126855

ekşiup linkleri için özür

https://eksiup.com/v/551547965
https://eksiup.com/v/551549029

burası istanbul şirinevler

ac02f No.127012

>>126625
türk iran kırması iskitlerden ya da kıpçaklardan bahsediyor olabilir

a01a0 No.127016

>>127012
Iskit ve Kipcak resmi tarihin en kullanisli Ingiliz anahtarlari zaten. Bu ikisini kullanip istedigin her yeri turk yapabiliyorsun.

87fd1 No.127385

File: 1621625267654.jpg (308.76 KB, 1208x1627, 1208:1627, E17sdyCXoAEj_Z7.jpg) ImgOps Google

cennetistanı karalama tiradları günümü yapıyor

3a8b8 No.127386

>>127385
Dan Brownlar ne alaka?

05f5d No.127419

https://youtu.be/8YB7HECJ5AI?t=110

-seni 5 yaşındayken tanıdım
+böylelikle şu ortaya çıkıyor benim hanımımla sen çocukluk arkadaşısın.

ne demek istiyor poğaçacı mıymış?

c0bd0 No.127537

>>127419
Abduş Dilipak Ertan Özyiğit'ten 13 yaş büyükmüş ve onun hanımı Ertan ile çocukluk arkadaşıymış. Yani Dilipak ve hanımı arasında 13-15 yaş fark var. Anonlardan biri ideal yaş farkı 15 diyordu, hatta Abduş 🌹 örneğini de veriyordu, 30 yaşındayken 15lik kız almış diye. Son zamanlarda ben de o anona hak vermeye başlıyor gibiyim.

5bdbb No.127581

File: 1621702843074.png (16.49 KB, 773x249, 773:249, xKkx9Vq.png) ImgOps Google


b8852 No.127649

File: 1621763674611.jpg (118.28 KB, 1253x708, 1253:708, 7yqxMne.jpg) ImgOps Google


8c9f5 No.127663

>>127649
Muh checks and balances. Korelasyon nedensellik değildir. Wilson sonrası ve öncesi cumhuriyetlerin çoğu sürekli birbirini siken paramileter gruplar, suikastler kısacası halkın iradesinin belleyecek her türlü siki barındıran manure gibi devletlerdi. Napolyon'un Ispanya'ya "demokrasi getirmesinin" nedeni zaten ülkeyi immobilize etmekti. Günümüzde bazı cumhuriyetler niye stabil diye sorarsan bkz https://en.m.wikipedia.org/wiki/Inverted_totalitarianism

9dc25 No.127697

>>127649
sorun diktatörlükte değil kötü halk ve bundan kaynaklanan kötü yönetimde
faşist almanya ve japon imparatorluğunda halk yaşamdan memnundu
bokçukurlarında hangi yönetim veya ekonomi sistemi uygulanırsa uygulansın sonuç değişmeyecektir- önemli olan ülkeyi oluşturan bireylerin genetiğidir

8c9f5 No.127728

>>127697
Lee Kuan Yew'i araştır. Türk halkı ahlaki olgunluk bakımından aşırı geri ama bunun genetikle ilgisi yok. Sadece hristiyanlığa göre felsefi derinliği olmayan bir dine mensup olduğumuzdan kültürel olarak barbarız. Bu da düzeltilmeyecek bir şey değil. Sadece kemalizm gibi demokrasiye aşırı önem veren jakobenlikten uzaklaşmamız gerek. https://en.m.wikipedia.org/wiki/Enlightened_absolutism

8c9f5 No.127742

>>127737
Kek. Kendin diyorsun adamların yaptığı işe saygısı, şerefleri var diye. Türkiye'deki zeka seviyesinin dusuklugunun yegane nedeni atalet; eğer meritokratik bir kültür oluşturabilirsek düzeltilemeyecek bir şey değil; sonuçta nijerya değiliz amk.

3ba66 No.127772

File: 1621802014834.png (498.98 KB, 382x512, 191:256, ClipboardImage.png) ImgOps Google

>>127737
senin gibi şu japon öven(adamlar şerefli zeki samuray insanlar hajum harakiri çekiyolar yauww) tayfadan nefret ediyorum.
- adamlar günde neredeyse türkler hatta daha fazla çalışıyor çalışmaktan masabaşında ölenler var. patron veya amir işyerini terk etmeden çıkma kültürü yok.
- aşırı biatçı bir kültürleri var hiçbir mobbing, taciz, haksızlık, suistimale ses çıkaramıyorsun. anında üzerinde toplum-mahalle baskısı oluşuyor ve dışlanıp sindiriliyorsun. adamların shogunluk zamanından beri toplumunda otorite öyle bir kutsanmış ve benimsenmiş ki adamlar kendi kendine otomatik öz denetleme kurmuşlar. o intiharlar da o sebepten şerefle falan alakası yok adamlar en ufak hatasında öyle bir dışlanıyor ve üzerinde baskı oluşuyor ki intihardan başka yapabilecekleri hiçbir şey kalmıyor.
- protesto-eylem kültürü yok. yakuza denen uluslararası ağa sahip mafyaları var. politikacıları üçüncü dünya ülkeleri gibi yolsuzlukla içe içe.
- tembel ve yalancı biri olsan bile toplumda bunları belli etmek sana çok zarar vereceinden herkes mülayimmiş gibi rol yapıyor aslında hepsi sosyopat böcek adamlar.
- en alkolik, sapkın,eşler arası aldatmanın yaygın olduğu, zenofobik, dejenere toplumlardan biri.
- bugün dünyanın en güçlü ekonomilerinden biri olma sebepleri amerika yönetiminde olmaları. güney kore de aynı şekilde.
- göt kadar evlerde yaşıyorlar.
- madem o kadar şerefli insanlarda 2. dünya savaşında amerikaya çoluk çocuk direnselerdi teslim olmak yerine? anayurtlarını savunsalardı gerilla savaşı yaparak? sözde güneşin oğlu imparatorları fare hirohito teslim olun dedi hepsi kuzu gibi oldu 2 atomdan sonra.
tabi sen de böcek adam olduğun için bunlar hoşuna gidebilir bilemem. türkiyede sürekli iran-rus-japon öven bir tayfa var bunlar geberse o kadar güzel olacak ki.

8c9f5 No.127773

File: 1621802347306.jpeg (14.81 KB, 274x184, 137:92, download (18).jpeg) ImgOps Google

>>127772
t. anarcho-bidenist

8df24 No.127775

>>127772
>- madem o kadar şerefli insanlarda 2. dünya savaşında amerikaya çoluk çocuk direnselerdi teslim olmak yerine?

ne kadar doğru bilmiyorum ama bana öğretilen zaten teslim olmadıkları için bombalandıklarıydı. "kaybettikleri belli olduğu halde adamlar savaşmaya devam ediyordu" gibi bir bilgi kalmış aklımda

ama caponlar hakkında dediklerine katılıyorum. caponlar masum görünümlü psikopat. dünyayı batı yerine japonya ya da çin yönetseydi çok vahşi görüntüler sergilenirdi

e80ac No.127807

File: 1621850258357.jpg (78.2 KB, 992x559, 992:559, elementary.jpg) ImgOps Google

Yarrakistan'ın okullarının etrafı neden duvarlarla kapalı? Etrafı mutlaka duvarlarla, çitlerle örülüdür, hatta lüks okullar kapıya bi de bekçi diker, okul değil auşwitz sanki siktiğimin yeri. Görseldeki ABD ilkokulu mesela. Hayatımda böyle okul görmedim ben tırrıkistan'da.

7eac5 No.127809

File: 1621851675297.jpg (154.29 KB, 1024x576, 16:9, DMq7NObXUAER83X.jpg) ImgOps Google

>>127807
wallaksi yaşayamadıks

46178 No.127812

>>127807
Veletler okulu rahatça kırmasın diye. Yoksa canı sıkılan kaçıp geri gelir ya da hiç gelmez

b2e0e No.127922

File: 1621951459204.png (955.25 KB, 1000x562, 500:281, ClipboardImage.png) ImgOps Google

Cennet vatanda ince belli çay bardağı center'a bakarken bulgur kaşıklama keyfi. Kültürümüz çok zengin.

https://www.youtube.com/watch?v=6skJL54e4ko

b2e0e No.127930

File: 1621956925805.png (105.04 KB, 500x507, 500:507, my disgust.png) ImgOps Google

https://twitter.com/Haberturk/status/1397176512697225217

>hava almak için dışarı çık

>sahilde kendi kendine otur
>adamın tekiyle eniğiyle oynarken göz göze gel
>sırf baktın diye adam seni uluorta boğazından tutup denize itsin
>kafanı betona çarpıp öl

Anasını avradını siktiğimin analistan denilen cehenneminde hiçbir neden yokken bile geberebilirsiniz. Kelimenin tam anlamıyla yaşatmıyor amına koduğumun t*rkiyesi. Şu lanet topraklardan ve şu illet milletten bütün benliğimle nefret ediyorum.

5a392 No.127932

>>127930
adamın sabıka kaydı nasıl merak ettim. her bir boku yapıp yine de dışarıda gezenlerdense daha da çok üzüleceğim

ec176 No.128024


ffc88 No.128156

File: 1622124669939.jpg (97.24 KB, 830x535, 166:107, anüs-estetik-ameliyatı.jpg) ImgOps Google

anüs=sulusıçıkiye

e0d26 No.128314


83e8a No.128469

File: 1622311222228-0.jpg (24.17 KB, 390x216, 65:36, 20210529_204130.jpg) ImgOps Google

File: 1622311222228-1.jpg (24.49 KB, 750x422, 375:211, 20210529_204132.jpg) ImgOps Google

File: 1622311222228-2.jpeg (35.12 KB, 400x300, 4:3, images - 2021-05-29T20484….jpeg) ImgOps Google

File: 1622311222228-3.jpeg (25.97 KB, 377x416, 29:32, images - 2021-05-29T20462….jpeg) ImgOps Google

t virusunun nihai hedefi yaradanin dunya uzerine verdigi tum guzellikleri tarumar etmek, tum dunyayi osmanli corabi kokusuna ve pislige bogmaktir.

79523 No.128478

https://youtu.be/gmMdV8DSqhk?t=6986

>toplumları bir şekilde organize edecek, kendine göre yönetecek akıl toplumların içini boşaltacak.

>içini boşalttıktan sonra biraz önce söylediğim gibi içine ne koyarsa onu alacak.
>ama bundan önce yaptığı bir şey var şüphe ettirmek ve kendinden nefret ettirmek.

63e53 No.128519

>>128478
>torununun bile odemeye devam edecegi eksi 60 milyar dolar net rezerv

Nefret et ya da etme, TC'ye giren her turlu girmis zaten. :D

a4376 No.128651

File: 1622469241317.gif (2.36 MB, 320x310, 32:31, 654.gif) ImgOps Google

>>128469
>t virüsü

61d24 No.128654

>>128651
>kesinlikle aynıibne değil

3ba66 No.128675

bir ülkenin suç kültürü bile bok mu kokar arkadaş
amerikada tehlikeli mahallelerde haftada en az birkaç kere ölümlü drive by shooting, silahlı cinayet, polis baskını, soygun falan oluyor. chicago, st louis, atlanta, new orleans, memphis, oakland gibi şehirlerde hoodlar tam savaş alanı. polis paranoyak sürekli tetikte. en ufak yanlışında üzerine şarjör boşaltıyor. ora alfaların memleketi burdaki gibi çakma fake ass kekoların yeri değil. burda millet eline bıçak-kurusıkı falan çıksın bağırsın çağırsın ya da birbirine sen kimsin lan diye boş boş diklensin. göbekli kara kuru anadolu çomarı polisler de karakolda kara bok çayını içtikten sonra tembel tembel gelip anam babam usülü müdahale etsin anca. orda biri cinnet geçirsin polisi çağırıp ar 15 ile ateş açsın sonra swat gelsin adamı delik deşik etsin aradaki farka bak. adamların suçlusu da polisi de gerçek ve cesur.

burdaki medya da beyni kızarmış bağımlı sabıkalı bir zenci, uyuşturucu satıcısı hispanik yada methead white trash komutlara uymayıp vurulunca boy boy amerikada polis şiddeti diye haber yapıyor. ekşide mal tipler de amerika hakkında filmler dışında bir boktan haberi olmadığı için amerikan polisine "ırkçı" ve "şiddet yanlısı" etiketini yapıştırıyor hemen. alışmışlar tabii burdaki gibi rezilliğe disiplinsizliğe kanunsuzluğa her yerin kendilerine benzemesini istiyorlar.
https://www.youtube.com/watch?v=91ZuIDAy1IY
https://www.youtube.com/watch?v=aCbOiiNT-LI

9fef9 No.128676

>>128675
tahta bile bok kokuyor söylediğin şeye bak. önce kendinizi sonra ülkeyi değiştirin.

a9629 No.129033

ananı avradını sikim bokistan dolar 8.72

ad422 No.129043

saatlerdir https://twitter.com/raporturkiye/status/1400361421356032004 şu videonun tiradını açacaksınız diye bekliyorum. bugün bir gariplik var sizde

d8b9f No.129310

File: 1622973778994.png (186.69 KB, 502x318, 251:159, yamtar bok fırtınası.png) ImgOps Google

bir ülke ve millet düşünün ki sevilecek hiçbir yanını bulamayasın. kültürü iğrenç ve fakir, tarhana halay ve zurna sazdan öteye gitmiyor hiçbir şey, adetlerinin göreneklerinin hepsi bok kokuyor ve boğucu, okulunda anlatılan tarihi "sultanalpaslan geldi gittieağ teşkilat kurdu savaşyapdı sonra ulu önder geldi kurtardıağ" kisvesinde beyin amcıklatan ucuz propagandayla karışık safi çorap kokusu, Türko tarihçiden okusan yine aynı durum, koca tarihi ve dili iki tane sikindirik devlet dairesine vermişler, kendi anadilinin kurallarını tdk denilen vakti zamanında dilin zaten anasını sikmiş olan yarardan çok zarar eden bir memur dairesinin gülsuyu kokan iğrenç websitesinden öğrenmeni isteyen bir toplum ve devlet bilinci var ortada. Dayatmacı, ezberci, paranoyak, tekdüze, kalite ve akıldan mahrum, yalan dolu bir eğitim müfredatının ilkokul sıralarından beri dayatıldığı zihnin hapsolduğu T.C denilen cehennemin dışındaki dünyayla tanışması ile beraber geçirdiği travma, aslında hiçbir şeyin sana dayattıkları gibi işlemediğini ve bir o kadar "bir türk dünyaya bedeldir" yamtarlığından sonra dünyanın bizi pek de siklemediği hatta tiksindiği gerçeği suratına vurunca geçirilen akıl tutulması ve mensup olduğun toplumun bulunduğu her yerde ecnebilerden tiksinti ve nefret ile karşılaştığı gerçeği, Aşağılık kompleksi, paranoya, "zamanında iyi koyduk hocum" hasar kontrolü, "you don't look turkish" ibaresini duyunca omurgasızlık nişanı olan istemsizce gelen sevinç ile *kşide başlık açmak, götüboklu arapların hatta farsların bile her yerde türkoların yüzüne tükürdüğü gerçeği, avrupalıların götünü yalama, arapların götünü yalama, orta asyalıların götünü yalama, yalama da yalama. bu millet anca başkalarının götünü yalar, kendisini kabul ettirmeye çalışır, doğu ve batının arasında sıkışıp kalmış ne idüğü belli olmayan dünyanın en sikten milleti.

bb6f1 No.129320

herhangi bir göt deliği > bu ülke

d8b9f No.129330

>>129329
r/bokistan subunun özeti: kedi kedi kedi kamal kamal kamal atam atam atam anzak anzak anzak irtica irtica irtica imamoğlu imamoğlu imamoğlu kedi kedi kedi atam.

başka bir sikim postladıkları yok.

d5275 No.129333

>hiçbir yeteneğin, hiçbir özelliğin, hiçbir hobin, hiçbir işin olmasın
>tüm gün ülkeye ve insanına hakaret et
>suçlusu onlar

2654d No.129358

>abdülhamit meclisi açılır açılmaz gibi kapatsın, 30 seneye anca bin türlü komployla indirilsin
>ittihat ve terakki üç günde mutlak gücü ele geçirsin, bir kişi bu adamlar ülkeyi ateşe atacak demesin
>kamal başa geçsin, herkes pozitivist kesilsin ülkenin dört bir yanında kuranlar yakılsın camiler ahır yapılsın
>demokrat parti dönemi gelsin cehape döneminden intikam alınsın
>60 darbesi 20 sene bayram diye kutlansın
>80 anayasası yüzde 90la kabul edilsin
>28 şubatta ülkenin büyük bölümü başörtü düsmanı laik kesilsin, islamcılara anca radikal solcular destek olsun
>akp iktidarı sonrası ülkenin yarısı soft islamcı osmanlıcı olsun diğer yarısının da büyük bölümü mavi vatan iha gazına gelsin, milyonlarca mülteci kamuoyunun umrunda olmasın
>daha ufak ölçekte kılışdar başa gelir gelmez partiyi kafasına göre yontsun, adamı indirme konusunda kimsenin en ufak bir şansı olmasın inceyle sarıgül kendilerini komik duruma düşürsünler
Başa kim geçmişse elindeki bütün araçlarla elinin ayarını bilmeden hükmetmiş, anca azınlık darbeleriyle indirilmişler sonra aynısını onlar yapmış. Komünist olsak Pol Pot'u kıskandırırdık, başa liberal biri gelse tüm ülke Las Vegas'a dönerdi. Türk insanı tarihin gördüğü en biatçı, en gücetapan topluluk mudur?

23f48 No.129364

>>129358
blue homeland kırmızı haptur

9fbc4 No.129366

>>129364
ironik olmayan biçimde r*dditte takılıp götü ona buna yanan spamcıya cevap veriyorsun, adam kanser hücresi gibi gittiği her yere NPC sıçmıklarını yazıyor.

2654d No.129368

>>129366
Haplarını al şizo

9fbc4 No.129378

File: 1623012553066.png (564.67 KB, 604x453, 4:3, you.jpg.jpeg.png) ImgOps Google

>>129368
sızlanmayı bırak, gerçekler acıdır.

1c7d6 No.129450

File: 1623070220919.jpg (61.4 KB, 1600x734, 800:367, Turk-bayrakli-turkiye-hari….jpg) ImgOps Google

>>129333
>bok kokuyorum
>suçlusu batı

85c85 No.129451


3023f No.129530

File: 1623103091813.jpg (34.66 KB, 700x450, 14:9, b954a700c4b1dfe73824ace2a1….jpg) ImgOps Google

.

ec0c9 No.129532

>>129530
>raegan hacum
>thotcher hacum
>özal hacum
vaxxxx

3023f No.129535

>>129532
çin-rusya-iran ve bilumum türkiye gibi corrupted 3. dünya ülkesi öven, üniter-milliyetçi-seküler, devlet fetişisti, soykırımcı diktatörlerin geri dönmesini uman, postal yalayıcı, mazoşist böcek adam mentaliteli, türk tarih kurumu ne derse papağan gibi tekrarlayan delüzyon içinde yaşayan bir ulusalcı olmaktan iyidir. devletin-liderlerin tarafından ne kadar sikilirsen o kadar zevk alıyorsun değil mi? sonuçta adam ayıya biniyo ağbii.

d8b9f No.129536

>>129535
ama biz gerçekleri böyle teker teker…(KURALLAR.HTML)

b6f2e No.129569

>>129536
Bildiğin r*dditçi shillisin d*scord k*nkilerinle siteye çökmeye utanmıyor musun?

7561e No.129571

Akdağmadeni Rum halayı: https://youtu.be/PpFQedQ37YI
Akdağmadeni b*zkır kertenkelesi çiftleşme dansı: https://youtu.be/xauzLoooXEE

d90fd No.129573

>>129535
Hiç olmazsa çin amerikkkaya kıyasla fonksiyonel bir ülke.

5ddbe No.129622

götüsikliyarrakistanamgülü

90cfb No.129623

File: 1623183673780.jpg (127.19 KB, 1080x876, 90:73, E3Wub7rXEAAYvOF.jpg) ImgOps Google

before/after

amerikan rüyası out
sulusıçkistan rüyası in

3023f No.129628

>>129573
ne açıdan?

3e95e No.129849

https://www.twitter.com/solcugazete/status/1392398705073008643

gece gece kanım çekildi lan. umarım solcu gavat dezenformasyonudur ya da annenin iftirasıdır

142b0 No.129869


714b2 No.129876

>>129869

her gördüğü twite atlayan aklı kıt solcular yıldırıyor insanları

91cb7 No.129933

File: 1623448388710.jpg (45.38 KB, 273x291, 91:97, teoman2.jpg) ImgOps Google

"Türkiye'den İstanbul'dan, Topkapı Garı'ndan, Türk Sanat Müziği'nden, türkülerden, tıklım tıklım otobüslere binerken başkalarının önüne geçmek için çabalamaktan, folklordan, futboldan, kuyruğa girmeyi bilmeyen insanlardan, çamurdan, mahallelerinden geçtiğimde sataşan çocuklardan, ter kokusundan, din ve turizm dersinden, sokak kapıları önündeki ayakkabılardan, maşrapadan, köylülerden, minibüs muavinlerinden, tığ işlerinden, gül suyu kokusundan, başörtüsünden, alaturka tuvaletten, seccadeden, elektrik ve su kesintilerinden, bağlama ve zurna sesinden, yemek yemekten, blok flütten, halay çekenlerden, göbek atanlardan, yemek kokan apartmanlardan, kalabalıktan, babasızlıktan, fakirlikten, sıskalığımdan, sevgilim olmamasından, utangaçlığımdan ve Türk olmaktan nefret ediyorum. Midemi bulandırıyor."

bc3de No.129934

File: 1623449708216.png (100.63 KB, 263x192, 263:192, ClipboardImage.png) ImgOps Google

>1000 liraya 1+1 dökük ev kiralamak iste
>emlakçı 1000 lira komisyon istesin
>ev sahibine 1000 lira kira ve 1000 lira depozito
>200 lira aidat

638ef No.129935

>>129933
her gün bir tiradın altına pastalıyorsun şunu. bıktırdın artık bu kanserden.

91cb7 No.129942

File: 1623453541521-0.png (30.3 KB, 669x282, 223:94, ClipboardImage.png) ImgOps Google

File: 1623453541521-1.png (7.28 KB, 656x80, 41:5, ClipboardImage.png) ImgOps Google

türklerin lisanla imtihanı.

570ec No.130205

Bağımsız (veya en azından özerk) Trakya Cumhuriyeti'ni destekliyorum ve bu konuda son derece ciddiyim, kesinlikle yemlemiyorum. Mevcut dövlet tarafından bilerek ve isteyerek aşırı vergi alınan, bu vergileri Anadolu sığırlarına veya k*rdolara akıtan, havası ve suyu açılan fabrikalarla bilerek pisletilen ve yine her köşeye fabrika/tekstil atölyesi vs. dikip yukarıda bahsettiğim subhumanların göç etmesi sağlanan, bu göç politikası yüzünden ülkede en fazla Covid vakalarının görüldüğü bölgelerden biri olmasına yol açan, sahil beldeleri hardcore şeriatçı/kafa kesen cihatçılar tarafından gizli gizli kiralanıp hücre evlerine dönüştürülen bir bölge haline geldi ve bu durum beni rahatsız ediyor (ya da buranın jargonuyla "götümü yakıyor"). Gavat Cehape ise bu konular hakkında HİÇBİR şey yapmıyor, tamamen "Eheh burada osbir çekip attırdığımız peçeteyi aday yapsak seçiliriz" kafasındalar ki bir nebze haklılar çünkü gerçekten seçiliyorlar fakat yavaş yavaş Akape bu bölgelere sızmaya ve belediyeleri ele geçirmeye başladı. Tek sağlam sayılabilecek kale olarak Edirne kaldı, oranın da başkanı (Recep Gürkan) tamamen Gavaddaroğlu ile olan kankalığı yüzünden başkanlığını sürdürebilen bir tip. Hatta belediye binasında Çakıcı'yı ağırlamıştı bu herif, ulan hatırladıkça göt yangını seviyem Vezüv yanardağı seviyesine çıkıyor amına koyayım! Ve Gavaddaroğlu Cehape'si elbette yine bunu aday gösterecek ve bir ilki gerçekleştirip Edirne'yi Akp'ye kaptıracak, kaçınılmaz son.

6a79f No.130245

File: 1623675788364.jpg (143.96 KB, 920x1024, 115:128, aa.jpg) ImgOps Google

https://twitter.com/ikoncuk/status/1403827229658955779

umarım doğru bilgilerdir. son yıllarda anti-akpliler(adamı tanımıyorum) de salaklaştı. güvenemiyorum

11750 No.130269

File: 1623690284982.jpg (92.34 KB, 720x960, 3:4, hmxt8ac4.jpg) ImgOps Google

sinan şamil sam heykeli

ee487 No.130270

>>130269
japon turist: biz ne alaka mqqqqq(KURALLAR.HTML)

6830e No.130284

File: 1623699156967.png (399.65 KB, 1259x466, 1259:466, üyk12.png) ImgOps Google

Sağcısı ayrı, solcusu ayrı, feministi ayrı, kemalisti ayrı, dincisi ayrı, her biri ayrı geri zekalı, borumbok bi toplum. Okumaz, merak etmez, gezmez, hasbel kader okuduğu üç beş sayfalık bilgilerle entelektüellik taslar. -De -da bağlaçlarını doğru yazan insan bu sikik topraklarda "entelektüel" sayılır. Şu amında beybileyt çevirdiğimin sitesinde bile bağlaçları doğru yazamayan insanlar gelip elitislik taslıyor. Ul*n maymuna eğitim veriyolar 2 senede işaret dilini öğreniyor, bunlar 7 yaşından beri şu boktan barbar lisanını öğrenemediler. Bu nasıl bir toplum bu nasıl bir millet? Tamam kardeşim her milletin aptalı saptalı çoğunluktur, Avrupa'da, Amerika'da vs. birbirinden geri zekalı bir ton insan var, var ama bi ülkenin %99.9'u embesil orospu çocuğu olur mu? İyi kötü bi entelijansiyası olmaz mı bi milletin yahu?

Sıçıp sıçıp kağıda çalan Cemal Süreya büyük şairdir, batıda kimsenin tanımadığı, siklemediği Celal Şengör, İlber Ortaylı gibi "bon pour l'orient" vasatlar büyük bilim insanıdır, bin şarkısından 995'inin tınısı ve melodisi birbirinin aynısı olan Zeki Müren gibiler büyük sanatçıdır. Yemin ederim şu tahtaya sırf bu tiratta içimi dökmek için giriyorum artık. Geçen başka bi tiratta daha yazmıştım yine yazıyorum, sorun AKP falan değil, bütün mesele 1071 Malazgirt savaşıyla başladı, kadim Helen kültürünün ve Roma medeniyetinin binbir emek ve fedakarlıkla inşa ettiği medeniyete bir avuç orta asya barbarı ve yanında orta doğu yamyamları geldiler çöktüler, sonuç ortada.

Bu bin yıllık ezikliğin yanında aşağılık kompleksi de cabası, deve sidiği içen Arap bile kandurasıyla, takunyasıyla gezmekten hicap duymaz, bizim eşek türkolar batıda "hiç t*rklere benzemiyosun" denince gururu okşanır. Geçen Fransız karının biri çıkıp: "t*rkler çok gösteriş meraklısı" dedi herkes el pençe "abi kadın haklı" moduna girdi. Kimse de demiyor ki ulan kahpe sen dünyada gösterişin, lüksün, burjuva modasının başkenti Fransa'dan geliyorsun sen kimsin diye. Sırf "batılı" ya ne dese doğrudur amına koyim. Bu ne tarifsiz bir ezikliktir ya rasul*llax? Bunda tabi Kamal'ın da payı var ama tek suç onun değil, bu bin yıllık faciaya tek adamı, tek partiyi, tek olayı fail göstermek saçmalık, dünden bugüne gelen bir tezek çığı bu ve gittikçe de artıyor. Benim derdim bu ülkede AKP, ekonomi, dolar şu kadar olmuş, asgari ücret bu kadarmış falan değil, benim tek derdim bu insanlığın bin sene gerisinde kalmış kokuşmuş toplum. Ne dostluğu dostluktur ne sevgililiği sevgililiktir, sevmeyi de öfkelenmeyi de insan gibi beceremez. Arabeskle, demagojiyle, popülizmle beslenen, 80 milyonluk yamyam sürüsü. Ta ellax'ın siktir ettiği mahalle nüfuslu İzlanda'dan bile ne sanatçılar ne akademisyenler çıkıyor ki tüm dünya tanıyor. Gel gelelim 80 milyonluk ülkede İlber Ortaylı'lar "entelektüel adam".

Ekim'de green card başvurumu yapıyorum ve bi daha ne t*rkçeyle ne de t*rkiyeyle ilgili tek bir şey, bırak konuşmayı, düşünmek bile istemiyorum artık. Orda soran olursa da İtalyanım ya da Yunanım derim bu kadar basit.

76dbf No.130290

>>130284
Tam vuruş

a8edc No.130291

>>130284
Sen olmuşsun anon. Aynı şeyi düşünüyorum ve kelimelere dökmüşsün. Göçebelikten gelen ve yerleşik yaşama uyum sağlayamamanın verdiği bir otizm var. Kilim desenli apartman sayısından bile bunu anlarız. Kıl çadırda sikişen barbarlar nereden bilsin medeniyeti? He sırf Türklere sallıyorum sanmayın Anadolu'daki her etnik gruptan ve kültürden nefret ediyorum. Keşke Kanadalı ya da ABD'li olsaydım.

7f924 No.130293

>>130284
şu siteye girip bütün dünya'ya sallıyorsunuz ya komiksiniz. önce kendinizi düzeltin kendinizi.

d85c7 No.130297

File: 1623712199435.jpg (112.36 KB, 900x900, 1:1, unnamed.jpg) ImgOps Google

>>130293
tamam erdem.(KURALLAR.HTML)

df438 No.130298

File: 1623715325996.gif (4.35 MB, 300x450, 2:3, tosun.gif) ImgOps Google

>>130293
Erdem YKS'ye 10 gün kaldı tahtalarda gezeceğine ders çalış.(KURALLAR.HTML)

43ff0 No.130299

File: 1623718851165.png (4.51 MB, 2056x1200, 257:150, 1613124332042.png) ImgOps Google

>>130298
üstardın çalışmasına gerek yok anonum zaten 100 puan cepte(KURALLAR.HTML)

13080 No.130305

adam askerini dikmiş sike sike kazdırıyor, hem de belediye başkanlığını kaybettiği şehirde. en önemli şehrini sikip atacak bu proje devam ederken pısırık t*rkler ne yapıyor peki bu sırada?

https://www.yenicaggazetesi.com.tr/kanal-istanbul-santiyesini-ibb-muhurledi-jandarma-yeniden-kurdu-457538h.htm

c5ef1 No.130307

>>130305
iç karışıklık çıksa da birkaç silah da ben sıksam keşke ama işte bu pısırık milletten bir halt olmaz

c2627 No.130520

File: 1623900819990.png (309.39 KB, 400x457, 400:457, ClipboardImage.png) ImgOps Google


59347 No.130688


6988f No.130734

>>130688
adamlar yavuklusunun adını yazmış. burada tahrip kastı yok.

e33c5 No.130896

File: 1624235095584.gif (927.5 KB, 394x279, 394:279, Jaed.gif) ImgOps Google

>filenin efeleri
>filenin sultanları

1f270 No.130898

File: 1624249698275.jpg (24.24 KB, 518x372, 259:186, 16dc0b4f951b4384fe8b8707d2….jpg) ImgOps Google

https://eksisozluk.com/avrupalilarin-turkiyeyi-dusman-olarak-gormesi--6953810?a=popular
>20 sene boyunca oraya buraya saldır
>ayak bastığın her yeri mahvet
>futbok maçında her türlü orkluğu ve pisliği yap, yok yere karşı tarafın milli marşını yuhala
>bizi niye sevmiyorlar bütün dünya bize komplo kuruyor REEEE
>hocum biz bunların 500 sene içinden geçtik ondan bu hınçları
>viyana kapuları hajum
>t. nenesinin tezekli divanından bulgurunu kaşıklarken tarihsel analiz sıçan yamtar bildirdi.
t orklarını dünya üzerinde kim seviyor? bir tek pakiler var onlar da diriliş ertuğrul izlemekten sikiş veriyor sadece. dizileri bırakıp t virüslerinin aralarında biraz vakit geçirseler onların da bunlardan tiksineceğine adım gibi eminim. literally dünyanın en çok tiksilinen ve nefret edilen milleti.

0aeb6 No.130919

File: 1624277275237.png (147.39 KB, 822x678, 137:113, Y7wLT76.png) ImgOps Google

İki ders var. Birincisi "sadece varlığımız bile batının götünü harlıyor hajum" diyenin (aslında yaşam kalitesi bunu 3'e 5'e katlayan batılının gram sikinde değilken) kendi götünün KÜRDlerin varlığında bile ÇITIR ÇITIR yanması. İkincisi de erl*k olayındaki gibi "bize özgürlük tanımıyorlar hacum" diyenlerin babasının malı olmayan uluslararası platformlarda KÜRDlerin istedikleri şeyleri yapması bir yana, görünürlüklerinin bile azalmasını istemeleri.

30e2a No.130923

>>130919
reddit ve wiki gayet kürdofil bir oluşum. wikide türkiye cumhuriyeti sayfasına: bunu mu demek istediniz bkz: "ermeni soykırmı" yazdırmaya çalışan dalyarakları hatırlıyorum. türkler orospu azınlıkları istemeyince suçlu mu oluyor şimdi

985fa No.130925

>>130923
Ermeni, Rum ve Süryani soykırımları olmasa türkiye cumhuriyeti diye bir yer olmayacaktı zaten. Başka ne yazdıracaktı ayrıca bakınız kısmına.

7dfac No.130934

>>130925
toplasan anadolu nüfusunun %20'si etmeyen azınlıkları amma abarttınız be.

962d6 No.130941

>>130923
(Götümü yakan herkes kürdofil)(KURALLAR.HTML)

f4cf6 No.130962

File: 1624309048591.png (8.28 KB, 256x256, 1:1, ZfV0alV.png) ImgOps Google


ed6c6 No.130983

File: 1624368279615.jpg (172.65 KB, 675x900, 3:4, c8gzjnjp.jpg) ImgOps Google

şunu şehir meydanındaki bir diğer sikindirik heykel sanmıştım, basit bir bahçe süsüymüş. yine de zevksiz.

yer: kırklareli

c228a No.130995

>>130284
>Orda soran olursa da İtalyanım ya da Yunanım derim bu kadar basit.

Burası ağır cringe hocum. Kendini avrupalı sanan kamalci gavatlarda avrupaya erasmusla falan gittiğinde aynı ucuzluğu sergiliyor. Yakışmadı.

659a0 No.130996

>>130995
Cringe demenin sebebi bunu yaptığında diğer t*rkoların gözünde nasıl değerleneceğini düşünmen. Çünkü "elalem ne der" zihniyetini o küflenmiş ortadoğu kafandan çıkaramıyorsun. Benim t*rke ve t*rklüğe dair hiçbir şey sikimin ucunda bile değil, arkamdan dişlerinizi bileyip sabaha kadar cringe deyin. Ben hiç tanımadığı insanların bile hayatında aldığı kararlara burnunu sokan neandertallerin olmadığı bir yere gidiyorum.

3c234 No.131018

orospu çocuğu

9ea82 No.131073

>>130995
Kompleksli cayır cayır yanan bir ekş*ci ile konuştuğunu yeni mi anladın anon?(KURALLAR.HTML)

f455d No.131161

kamal: bütün umudum gençliktedir
o sırada bokistan gençliği: https://www.youtube.com/watch?v=2TRp4PwLO2A

şimdi 10 yıl sonrasını hayal edin, bu tiplerin 28-30 yaşlarında olduğu zamanlar. bu ülkenin hali ne olur?

8c9b1 No.131168

>>131164
Toprağı suyu zehirli bu ülkenin

9ed4c No.131211

https://eksisozluk.com/katarli-genclere-turkiyede-sinavsiz-tip-hakki--6958917
bu tırıklar katarı ırak suriye gibi bir ülkemi sanıyor? milyoner olmayan katarlı yok gelip ilk 500de bir üniversitesi bile olmayan bokistanda tıp mı okucaklar?

528d9 No.131212


0f6ab No.131232

>>131211
Protokolde sadece Katar Türkiye'ye öğrenci yollar yazmıyor bu arada. Zannedersem öğrenci değişimi gibi bir şey olacak.

>Eğitim dili Türkiye Cumhuriyeti’nde Türkçe/İngilizce, Katar Devleti’nde Arapça/İngilizcedir. Bir yılı aşan eğitim ve öğretimler Türkiye Cumhuriyeti’nde Türkçe, Katar Devleti’nde Arapça verilir. Misafir Personel ve Misafir Öğrenciler, öngörülen eğitime başarılı şekilde devam edebilecek seviyede Kabul Eden Tarafın eğitim dilini bilir.


Asıl Katarlıların üzülmesi lazım ilk 500'de tek üniversitesi bulunmayan bok kokulu orklar bizim tıp fakültelerini istila edecek diye.

cd96e No.131265

>>131211

amcası astsubay olan bir türko gidip katarda tıp okuyabilir mi? belki zengin bir katarlıyla evlenir hayatı kurtulur

df33d No.131333

File: 1624724594230.mp4 (18.92 MB, 640x1136, 40:71, 10000000_485891842470089_3….mp4) ImgOps Google

gta turkey

2b05a No.131335

>>131333
amerikalı: *gta'yı kodlar*
urfalı: bitch please

cd96e No.131369

>>131333
biri de evine çıkıp silahını almamış. karadenizde olsa aracı tararlardı.

ce866 No.131431

>>131333
Hayatımda ilk kez sabahın 5'inde bir video izleyip de bu kadar çok güldüm. aşırı eğlenceli değil miydi ya? Kek:d bir de içimden 'ya geri dönüp keşke bir daha ezse'dedikten sonra aynen bunu yapmasına x2 daha çok güldüm. Theync'e kesin düşmüştür bu video. Neyseki ülkede şöyle şeyler yaşanıyor da gülebiliyorum.

5630c No.131434

>>131333
arabanın şoförü ne kadar rahat. yavaş gitmesi beni güldürdü. arabaya kafa atmaya çalışmaları da güldürdü. ama aslında kötü bir şey yani.

82cd1 No.131437

File: 1624774199355.jpg (66.17 KB, 800x787, 800:787, 168842736_107987364730119_….jpg) ImgOps Google

>>131434
siktiminin roachlarında gram beyin yok vallaxi. Ulan araba tüm sülalenin bokunu çıkarmış hala üstüne gelirken kaldırıma çıkmıyorsun

9830c No.131462

https://twitter.com/dw_turkce/status/1408764480704679936
biraz da afrikalı kardeşlerimiz tcnin fırsatlarından faydalansın

f2006 No.131535

>>131437
>urfa
>roach
anon ne konuştuğuna dikkat et. o insanlar muhtemelen üstün Kürt ırkına mensup.

f2006 No.131536

File: 1624922245191.png (841.12 KB, 673x905, 673:905, ClipboardImage.png) ImgOps Google


cf6d6 No.131538

File: 1624924469768.jpg (29.96 KB, 900x506, 450:253, v3yvy5ol4cy61.jpg) ImgOps Google

>>131536
>bin yıldır bu topraklardayız hâlâ mimari kültürümüz yok

bu koydu. ulan her nesil gıdım gıdım sanata ve bilime önem verseydi şuan uzaydaydık be. babam bile akşam lisesine gitmek istediğinde d*dem "gündüz ohumadın akşem mi ohuyaceğn" diye izin vermemiş.

cf6d6 No.131546

zeytin ülkesi türkiye'de zeytinyağının dünyanın en yüksek fiyatına satılması gibi, fındık ülkesinde avrupa'ya yok pahasına sattığın fındığın kendi vatandaşına dünyanın 3 katı fiyatına satılması gibi, ortadoğudaki petrol kaynaklarına neredeyse yürüme mesafesindeki türkiye'de benzinin dünyanın en yüksek fiyatına satılması gibi;
3 tarafı denizlerle çevrili güzel ülkemde de sıradan bir yerde bile bir tabak kalamar, bir tabak karides 70-80 tl olmuş. herhangi sıradan mekanda bir istavriti bile 50-60 tl'den aşağı yiyemiyorsun. hakeza çiftlik levrek ve çipuralar da bu fiyatlarda. kalkan, lüfer, barbun artık ulaşılmaz olmuş. afrika'ya, uzakdoğuya gidiyorsun adamlar koskoca karışık deniz ürünleri tabağı getiriyor, 3-5 dolar.

cf6d6 No.131547

>>131546
>güzel ülkem
>

pastalarken görmemişim cringe için kusura bakmayın

972f5 No.131557

>>131546
"Enayi türkolar her türlü alır" mantığıyla siklerinin keyfine göre zam yapıyorlar ve sonra doları (ulan zeytinyağı ile dolar ne alaka) falan bahane ediyorlar. Yine de her türlü parayı götürüyorlar çünkü dediğim gibi enayilikten, şükürcülükten, hak arama gibi bir derdi olmayışından.

f7bc5 No.131561

>>131557
>ulan zeytinyağı ile dolar ne alaka
Yetistirmesi, toplamasi, sikmasi, paketlemesi, sana gelmesi; vida bile uretemeyenlerin ulkesinde hepsi ithal makinelerle yapiliyor. Dolari bu ulkeden cikar ulke cilali tas devrine geri doner.

f2006 No.131563

File: 1624994542868.jpg (49.61 KB, 577x1024, 577:1024, E5EMGoyXMAAkqhh.jpg) ImgOps Google

duvardakiadaletyazısınagülüyorumistan

eab8a No.131564

Bu ülkeden gitmeyi kafama o kadar taktım ki, geçen liseden bi arkımla karşılaştım, gel bişeyler içelim dedi çok ısrar etti, meşgulum deyince telefonunu verdi nolur ara buluşalım falan filan dedi ona bile pas vermedim. Olur da eskisi gibi tekrar sıkı dost olursak gittiğimde adamı özlemeyim diye. Gittiğimde hiçbir şeyi özlemeyecek konuma soktum kendimi. Zihnen hazırım.

eb8ce No.131573

>>131564
Abartmışsın sende anon.

a8b8f No.131574

>>131564
Seni kim alacak da böyle hazırlanıyorsun? Avrupa'da 4 milyon Türk var, sana yer kalacak mı?

02ddc No.131575

File: 1625008621220.jpg (32.44 KB, 600x474, 100:79, eğitilemez.jpg) ImgOps Google

>>131573
De ayrı

>>131574
Avrupa'ya gitmiyorum bu bir, postumda "gittiğimde herkes bana kucak açacak" gibi bir ima yok bu da iki.

Okuduğunu anlamayan, kendi dilini bile yazamayan barbarlar iyi ki varsınız, siz olmasanız bu zehirli topraklardan kaçacak motivasyonum olmazdı.

>de da ekinden kişilik analizi yapıyor hurr durr

Hayır, 7 yaşından beri eğitimini aldığı bir şeyi öğrenememiş bir yaratığın kişilik analizini yapıyorum. Saygılar.

4886d No.131576

>>131575
Gecenin bu saattinde tanimadigim kimse icin essay yazmam anon o kadar kompleksli bir otist değilim kusura bakma

d1f03 No.131585

File: 1625043553876-0.jpg (197.23 KB, 784x1495, 784:1495, gazete1.jpg) ImgOps Google

File: 1625043553876-1.jpg (517.14 KB, 760x1976, 5:13, gazete2.jpg) ImgOps Google

File: 1625043553876-2.jpg (261.31 KB, 1080x1096, 135:137, gazete3.jpg) ImgOps Google

File: 1625043553876-3.jpg (397.13 KB, 710x1680, 71:168, gazete4.jpg) ImgOps Google

File: 1625043553876-4.jpg (284.92 KB, 805x1912, 805:1912, gazete5.jpg) ImgOps Google

Zeytin için cennet iklime sahip olmasına rağmen yarak gibi ve üstelik pahalı zeytin yenmesinin sebebi nedir? Cevap çok basit, yüzlerce yıldır zeytincilikle uğraşan, zeytin kültürü ve know-how'ı edinmiş azınlığı kovalayıp malına mülküne çöküp o bilgiyi edinememiş olmak. Açgözlülük, para ve mal mülk hariç hiçbir şeye değer vermemek.

Akdeniz gibi lezzetli ve orta-küçük sınırsız balık çeşidine sahip bir coğrafyaya rağmen yarak gibi balıklar yememizin, balık yemenin lüks oluşunun, deniz ürünü kültürü olmayışının, denize sıfır restoranlarda yiyebildiğiniz en değişik şeyin mangalda levrek oluşunun sebebi nedir? Cevap çok basit, yüzlerce yıldır balığın ne olduğunu bilen, nesilden nesle deniz ürünü kültürünü aşılayan, deniz ürünü ticareti yapan, deniz ürünü mutfağını avcunun içi gibi bilen azınlığı kovalayıp malına mülküne çöküp o bilgiyi edinememiş olmak. Açgözlülük, para ve mal mülk hariç hiçbir şeye değer vermemek.

Fındık için cennet iklime sahip olmasına rağmen kalitesiz ve pahalı fındık üretilmesinin sebebi nedir? Cevap çok basit, yüzlerce yıldır fındık işiyle uğraşan, fındığın ne olduğunu bilen azınlığı asimile edip dünyanın en azılı türko milliyetçilerine çevirmek. Kovalanmamış olsalar da kanser ideolojisi ve dinine silah zoruyla adapte edildikleri için kültürlerini unutmuş olmaları.

Ülkede hala lezzetli kalabilmiş mutfakların hangi kültürlerden geldiğini ufak bir google aramasıyla öğrenebilirsiniz. Bugün bildiğiniz mega holdinglerin, hangi kesimlerin malına mülküne çökerek zengin olduğunu aratabilirsiniz. Ülkenin bütün sistematiğinin azınlığın ürettiğine çökmek üzerine kurulu olduğunu, çökülecek, gücü yetilecek azınlık kalmayınca kendini yemeye başladığını görebilirsiniz.

Kuzey koreden farkı yok diyoruz, abartma sen de diyorlar. Kuzey kore propagandası sonunda çatlayıp kırılmaya başladı, insanlar onun şokunu yaşıyorlar diyoruz, hadi canım diyorlar. Tiradlar açıp zumcuları bilgilendirmeye çalışıyoruz, tunay özden aydıncı sanıp banlıyor. Zumcular çareyi chpde arıyor, sorunun devletin temellerinde olduğunu göremiyor. "evil akp" gidince hiçbir şey düzelmeyecek haberiniz olsun

f3f17 No.131592

File: 1625052659156.jpg (122.55 KB, 1024x768, 4:3, k7dzioy8.jpg) ImgOps Google

>>131563
Hatunun hiçbir albenisi yok gayet vasat, buna rağmen bir sürü sevgilisi varmış.

17001 No.131599

File: 1625064050997.jpg (85.08 KB, 586x689, 586:689, 203802249_291830385957814_….jpg) ImgOps Google

zengin bir akrabam var adam sürekli işlenmiş sikko plastik şeyler yiyor doğal et tavuk balık sevmiyor sebzenin yanından geçmez yemek bile saymaz. geçen öğrendim hasta olmuş. yaşı 30'a yakın ama beyin yaşı 15. birkaç seneye iyice çöker testosu düştükçe. ulan milletin parası var değerlendirmiyor ben protein almak için haşlanmış yumurta yemekten tiksindim. bokistanın zengini de beyinsiz arkadaş.

a8b8f No.131602

File: 1625066115750.mp4 (2.7 MB, 576x1024, 9:16, 77f079fad8e51e49070c5d9ac3….mp4) ImgOps Google

Butun dunya bu ulkeden nefret ediyor, millet ucuz tatil ve kiyafet icin kitalar otesinden geliyor. Tesekkurler bizi somurgeye donusturdugunuz icin.

10 yil sonra bu ulke ayakta kalabilir mi?

a7cf9 No.131616

HARBİDEN ÇOK AĞIR TAŞŞŞAK GEÇİYORLAR

https://twitter.com/NoContextSag/status/1410303971496009729

d1f03 No.131617

>>131616
İyi yapıyorlar, hayatı sikilirken yaptıkları tek şey twitter'da mizah olan enayilere az bile yapılıyor. Bu gidişle cucklara pogrom yapılacak hala espri yarışındalar.

7ca25 No.131627

hadi z kuşağı bu boktan dönemde doğup büyüdü o yüzden bazı şeyler o kadar canlarını yakmıyor ya da mizahını yapıp geçiyorlar. ancak dünyanın en ama en şanssız kitlesi bu ülkedeki muhalif y kuşağıdır. bu kuşak bildiğin harcandı be, ya yandaş olmaya zorlandı ya da olmayıp hayatı sikildi.

cd96e No.131639

>>131627
y kuşağının muhalif olduğunu sanmıyorum anon. geziden beri böyle bir goygoy vardı, y kuşağı bizi kurtarır diye düşündü muhalifler. öyle olmadı.

35614 No.131647

File: 1625118736436.png (413.16 KB, 770x733, 770:733, serap sikildin kızım.png) ImgOps Google

>>131627
Y kuşağı da en az z kuşağı kadar geri zekalıydı, popüler kültürün köpeğiydi, özentiydi, tüketmekten başka bi sike yaramazdı, aptal orospu çocuğu gibi en boktan ürün için bile marka muhabbeti yapardı, lümpendi, alkol içmekle övünürdü, "ben çok sikişiyorum hacum" diye gezen ego problemli salaklardı. Lise + üniversite hayatını 2009-2017 yılları arasında geçirmiş, ortamlara girip çıkmış, konserlere gitmiş bir y kuşağı olarak bunu rahatlıkla söyleyebilirim. Y kuşağını en iyi anlatan film Bornova Bornova'dır, herkesin izlemesini tavsiye ediyorum, youtube'da var. Sosyal medya denen boku bu günlere getiren de y kuşağıdır, insanlar bunu hep unutuyor. Herkesin gittiği mekanı "mentionladığı" i'm at athena konseri, i'm at bilmemne'li o boktan yılları çok çabuk unutmuşsunuz.

Zaten bu kuşak terimlerini batılı sosyologlar batı toplumları için ürettiler, ortadoğu her zamanki gibi batıda üretileni olduğu gibi ithal etme derdinde, bin senedir adam gibi eğitimin olmadığı, ilk 500de ünisinin olmadığı, herkesin maaşlı bi işe girip hamster kafesi hayatına heveslendiği, hayallerinin peşinden koşanın aptal, salak, bilinçsiz diye yaftalandığı bu zehirli toprakların sosyolojisiyle batınınki bir değil.

Ama şunu söyleyim en azından y kuşağı derme çatma bir beyaz yakalı hayatına tutunabildi, z kuşağının sonu turizm/hizmet sektöründe kölelik yapmak ya da 50 yaşına kadar anneleriyle yaşamak, ya da son çare intihar. Toplu zoomer intiharlarına son 4-5 sene kaldı. Tabi içlerinde aklını kullanıp orkistan'ı terk etmek için çok çalışanlar da var, bunlar zaten y kuşağında da vardı hepsi çoktan gitti kurtuldu (örnek T*nay), reyis'in dediği gibi kalanlar tuzağa düştü.

cd96e No.131651

>>131647
anketlere bakarsak tarhana reich'in sonuna geldik anon. göbeği açık zoomerlar beyaz atlarına binip bizi kurtaracaklar.

y kuşağının anketlere bir etkisi olduğuna şahit olmadı. hepsi gitti çomar ailesinin dediğine oy verdi.

cd96e No.131658

>>131652
>>131656

tüm dünyada milliyetçilik yükselirken tecede mucize mi bekliyorsunuz? paradigma bu ne yapalım

0e902 No.131659

>>131658
>tüm dünyada milliyetçilik yükselirken

Batı toplumlarında birey diye bi kavram vardır, anadolu orklarının bunu bilmemesi gayet doğal.

Çoğu Avrupa ülkesinde aktüel politika da pek siklenmez, oy kullanma oranları da düşüktür, Amerika'da bile rekor geçen 2020 seçimlerinde kırıldı ve oran %66.

Politikadaki "trend"ler bir toplumu şekillendiriyorsa o toplum birey olamamış, bok kokulu bir ork sürüsüdür. Zaten "başımıza x geçince kurtulacaz" mantığı biz sürüyüz bizi güdün itirafıdır. Hayır anlamıyorum, artık bu orkların geri zekalılığı hafsalama sığmıyor, 1800'lerden beri x gelince bu iş tamamdır mantığıyla yaşadınız, geldiniz geldiniz bu günlere, biri bile çıkıp "lan bi dk bu işte bi yanlışlık var" demez mi? Sizden tüm benliğimle tiksiniyorum.

Bu hayattaki en büyük yaşama motivasyonum akp gidince her şey düzelecek sanan orkların sefaletini Minnesotta'daki müstakil bahçeli evimden izlemek. En büyük hayalim bu artık.

cd96e No.131661

File: 1625130303761.gif (56.7 KB, 800x581, 800:581, individualism-map.gif) ImgOps Google

>>131659
>Batı toplumlarında birey diye bi kavram vardır, anadolu orklarının bunu bilmemesi gayet doğal

konunun bireyciliğe gelmesinin saçmalığını geçelim ve devam edelim.
anadolulu birey olmayı bilmemeyi geçtim bireyin allahıdır. anadolulu bireycilikte doğu avrupadaki birçok halktan daha ileridedir. bunu okulda, iş hayatında, atasözlerinde buz gibi hissettirler. bakarsan modern bireycilği sistematize eden bütün filozoflar bu topraklardan çıkmış. hoş yunanistan bile bizden daha az bireyci ama önemliymiş gibi kabul edelim.
"tarhane reich bitecek çünkü empirik veriler bunu gösteriyor" demişim. sen bokistan düzelecek falan dediğimi sanmışsın. millete ork demeden önce okumayı öğrenmeni tavsiye ederim. anadolulunun bireyciliğini beğenmeyen daha bireyci yallah irana gidebilir.

6b5cd No.131662

File: 1625131019787.jpg (172.36 KB, 1122x1366, 561:683, E5H6SmHX0AAb3Nj.jpg) ImgOps Google

>>131660
>90'larda dışarıya açılmanın travmasını hala daha yaşıyor ve bir türlü dış dünyaya adapte olmayı beceremedi.
80'ler demek istedin galiba. Türkiye'nin küresel ekonomik sisteme eklemlenmesi 24 ocak kararlarından sonra gerçekleşti.

>100 senedir aynı cennetvatan millet sakarya kafa yapısı dominant

Kutsal devlet anlayışı ve halkın tebaalığı benimsemesi cumhuriyetten daha eskiye, osmanlıya dayanıyor.

>varlığım t*rk varlığına armağan olsun gibi içiboş laflar

Andımız çok uzun süre önce kaldırıldı şimdiki liselilere sorsan ne olduğunu bile bilmez.

>vasat diktatör

Diktatör olsa terrakiperver cumhuriyet fırkası gibi muhalefet partilerinin kurulmasını desteklemezdi, mutlak güç elde etmek isteyen birisi olsaydı yönetim biçimi olarak parlamenter demokrasiyi seçmezdi anon.

Sırf köşeli olmak için ülkeyi biraz olsun ileri götürmeyi başarabilmiş adama hakaret etmen cringe. Hakaret ettiğin adam olmasaydı şu an Suriye, Irak, İran seviyesindeki bir ülkede yaşıyor olurdun. Az biraz minnet göster nankör herif.

67eb8 No.131665

File: 1625133500654.jpg (241.8 KB, 600x690, 20:23, girdi mi.jpg) ImgOps Google

>>131661
Kekullah be kardeşim bu nasıl bir aptallık paylaştığın görsel bile anlattığım şeyi kanıtlıyor kendi postunu da yalanlıyor, üstelik individualism eşit değildir birey olabilmek. Axxx orklar axxx pol'den bir iki grafik pastalayınca olmuyo o işler be.

29b4c No.131667

>>124970
Eski bir post ama şimdi gördüm. Amerika'da Imagine Dragons'un rock olmadığı, rock müziğe zarar verdiği, piyasa grubu olduğu falan tartışılıyor bizim burda gençler bunu dinleyip "möthiş şarkı" falan diye yorum atıyor. İnnovasyon yok bu siktiğimin topraklarında, 85 milyon zombi popüler kültür ne emrederse onu yapıyor.

933e2 No.131669

>le bu ülkenin hiçbir şeyi mi iyi olmaz

türk çen sitesinin durumu:

08be6 No.131702

File: 1625155512661.mp4 (1.55 MB, 384x480, 4:5, arap efendilerimiz.mp4) ImgOps Google

lira = sümüklü peçete

c87bd No.131703

>>131702
>lirayı değersizleştirenlere sesini çıkarama
>lirayı değersizleştirenleri seçen halka sesini çıkarama
>arrablarun amug dünyanun en pis milletü hepsnü yog edeceksün

569df No.131709

File: 1625162973829.jpg (471.94 KB, 1812x2003, 1812:2003, oD3v990.jpg) ImgOps Google


652b5 No.131730

iq ortalaması 89 olan bokistana tutunamamış vasıfsız sıçmıklar minnesota'da lordluk hayali kuruyor keeek.

he birey he.

43d13 No.131734

>>131730
Kek bu nasıl geri zekalıca bi posttur, siktirboktan lcw tezgahtarının bile torpille işe alındığı bir ülkede tutunamadım evet, o yüzden çalışmaya ve vizyona önem verilen bir ülkeye gidiyorum. Neyse "bakir değilim" dediğimde bile yumruğunu ısırıp "zihinnn" diyen siz zavallılara laf anlatamayacağım.

652b5 No.131737

File: 1625183259561.png (141.82 KB, 435x711, 145:237, 16FhW7Z.png) ImgOps Google

aşırı antidepresan kullanımından beyni yanmış ve HİÇBİR vasfı olmamasına rağmen delüzyonlarda yaşayan, kendini orta doğunun aristokratı ilan eden, bakirliğinin, başarısızlığının müsebbibi çevresindeki orklar zanneden, çevresindeki orklar kadar bile olamayan, sorumluluk almaktan kaçınan düşük testosteron sahibi bir avuç gerizekalıya bakın ve gülün. yapmaya çalıştığınız şey mario'da daha 1. seviyede başarısız olup 5. seviyede başarılı olacağınızı zannetmektir. bokistan her halükarda kolay bir ülkedir. okuma yazma bilen, uzuvlarında bir eksiklik olmayan birisinin başarısız olması imkansızdır. e siz bunu yapamıyorsanız ortalama 89iq'nun da altındasınız demektir. ananızın döl kokan odasında minnesota'da şato hayali kurmak yerine 10 tavuk yetiştirseniz insanlığa daha fazla faydanız olur.

almancı üstandın da dediği gibi HİÇBİR vasfınız yok ve HİÇBİR yere gidemeyeceksiniz.

c966f No.131738

File: 1625184471211.mp4 (676.67 KB, 720x626, 360:313, gigalol.mp4) ImgOps Google

>>131737
>batıda başarılı olmayı imkansız bir şey sanmak

aşağılık kompleksi + vizyonsuzluk + poşet kafalı bir ana = bu anon

652b5 No.131739

File: 1625185385207.jpg (361.54 KB, 1300x1300, 1:1, iq-europe.jpg) ImgOps Google

>>131738
ortalama 89 iq'lu insanlarla rekabet edememişsen ortalama 105 iq ile rekabet etmen daha zorlu olur. hukukçular buna evleviyet der.
batıda başarılı olunacaksa onu da biz oluruz. adam hatay'ın köyünden almanyaya gider covid'e aşı üretir siz de mal mal tahtaya sıçarsınız. şato sahibi olunacaksa, lordluk ve sir'lük ünvanı sahibi olunacaksa onu da biz oluruz.

57bad No.131740

File: 1625185560388.png (67.41 KB, 840x684, 70:57, ayküğ.png) ImgOps Google

>>131739
>ayküüüğ

senin gibi eşşekler batıda çoktan taşak malzemesi oldu, sen gelme uzaktan haset duy sadece :D

47d50 No.131741

Hoooop 250 post ve kapanis.

Bu tirad dusene kadar yenisini acmayin.



[Return][Go to top] [Catalog] [Post a Reply]
[ [ < ] [ b / g / s / v ] [ Kurallar / Stats ] ]